Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636587_at:

>probe:Drosophila_2:1636587_at:235:533; Interrogation_Position=1129; Antisense; GGTGAACTTATATCAGCTGCTGAGC
>probe:Drosophila_2:1636587_at:363:421; Interrogation_Position=1150; Antisense; GAGCAAGTTCAATGGCACTGCCGAA
>probe:Drosophila_2:1636587_at:441:473; Interrogation_Position=1237; Antisense; GTTCATCATTCTGTACATCAAGCGA
>probe:Drosophila_2:1636587_at:632:3; Interrogation_Position=1301; Antisense; ATTGTGAACTTTCCCATCAAGCACG
>probe:Drosophila_2:1636587_at:288:651; Interrogation_Position=1317; Antisense; TCAAGCACGTGGACTTTGGCGACAT
>probe:Drosophila_2:1636587_at:656:727; Interrogation_Position=1332; Antisense; TTGGCGACATTCTGGGCATGCGGCA
>probe:Drosophila_2:1636587_at:28:641; Interrogation_Position=1390; Antisense; TCTGGTGGCCAATATTGTGCACGAC
>probe:Drosophila_2:1636587_at:650:615; Interrogation_Position=1452; Antisense; TGCACAAGGCCAACGGTCAGTGGTA
>probe:Drosophila_2:1636587_at:687:617; Interrogation_Position=1482; Antisense; TGCAGGATCTGCATGTCACCGAGAT
>probe:Drosophila_2:1636587_at:436:61; Interrogation_Position=1494; Antisense; ATGTCACCGAGATACTGCCGCAGAT
>probe:Drosophila_2:1636587_at:412:99; Interrogation_Position=1515; Antisense; AGATGATCACGCTCACCGAGTCCTA
>probe:Drosophila_2:1636587_at:455:431; Interrogation_Position=1532; Antisense; GAGTCCTACATCCAAATCTACGAGC
>probe:Drosophila_2:1636587_at:605:281; Interrogation_Position=1570; Antisense; CTCGTGATCCACCTGACTTTTAATA
>probe:Drosophila_2:1636587_at:242:123; Interrogation_Position=1660; Antisense; AGCGACTATGAGTGGCCCTTGAATA

Paste this into a BLAST search page for me
GGTGAACTTATATCAGCTGCTGAGCGAGCAAGTTCAATGGCACTGCCGAAGTTCATCATTCTGTACATCAAGCGAATTGTGAACTTTCCCATCAAGCACGTCAAGCACGTGGACTTTGGCGACATTTGGCGACATTCTGGGCATGCGGCATCTGGTGGCCAATATTGTGCACGACTGCACAAGGCCAACGGTCAGTGGTATGCAGGATCTGCATGTCACCGAGATATGTCACCGAGATACTGCCGCAGATAGATGATCACGCTCACCGAGTCCTAGAGTCCTACATCCAAATCTACGAGCCTCGTGATCCACCTGACTTTTAATAAGCGACTATGAGTGGCCCTTGAATA

Full Affymetrix probeset data:

Annotations for 1636587_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime