Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636589_s_at:

>probe:Drosophila_2:1636589_s_at:456:349; Interrogation_Position=120; Antisense; GCAGGACCTGCTCAAGAATATCTAT
>probe:Drosophila_2:1636589_s_at:616:223; Interrogation_Position=157; Antisense; AAGGATAACGAAGGTGCCATCACCT
>probe:Drosophila_2:1636589_s_at:709:535; Interrogation_Position=169; Antisense; GGTGCCATCACCTCGAAGGAATTGG
>probe:Drosophila_2:1636589_s_at:688:47; Interrogation_Position=196; Antisense; ATGGTAATCCGAGCATTAGGTCGAC
>probe:Drosophila_2:1636589_s_at:41:343; Interrogation_Position=208; Antisense; GCATTAGGTCGACAGCCCAATGAAT
>probe:Drosophila_2:1636589_s_at:308:643; Interrogation_Position=312; Antisense; TCTGCGCAAGATGCACGACACAAAT
>probe:Drosophila_2:1636589_s_at:303:419; Interrogation_Position=346; Antisense; GAGCTGCGCGATGCGTTTCGCGTTT
>probe:Drosophila_2:1636589_s_at:326:51; Interrogation_Position=356; Antisense; ATGCGTTTCGCGTTTTTGATAAGGA
>probe:Drosophila_2:1636589_s_at:462:185; Interrogation_Position=382; Antisense; AACAATGGGTACATCTCCACTACCG
>probe:Drosophila_2:1636589_s_at:123:607; Interrogation_Position=410; Antisense; TGAGGGCTGTCTTTATGGCACTTGG
>probe:Drosophila_2:1636589_s_at:490:571; Interrogation_Position=414; Antisense; GGCTGTCTTTATGGCACTTGGTGAA
>probe:Drosophila_2:1636589_s_at:552:299; Interrogation_Position=472; Antisense; CGCGAGTACGATTTAGATCAGGATA
>probe:Drosophila_2:1636589_s_at:125:543; Interrogation_Position=492; Antisense; GGATAATCACATCAATTTCGAGGAG
>probe:Drosophila_2:1636589_s_at:331:65; Interrogation_Position=97; Antisense; ATGGATGAATTGTCTGTTGAAGAGC

Paste this into a BLAST search page for me
GCAGGACCTGCTCAAGAATATCTATAAGGATAACGAAGGTGCCATCACCTGGTGCCATCACCTCGAAGGAATTGGATGGTAATCCGAGCATTAGGTCGACGCATTAGGTCGACAGCCCAATGAATTCTGCGCAAGATGCACGACACAAATGAGCTGCGCGATGCGTTTCGCGTTTATGCGTTTCGCGTTTTTGATAAGGAAACAATGGGTACATCTCCACTACCGTGAGGGCTGTCTTTATGGCACTTGGGGCTGTCTTTATGGCACTTGGTGAACGCGAGTACGATTTAGATCAGGATAGGATAATCACATCAATTTCGAGGAGATGGATGAATTGTCTGTTGAAGAGC

Full Affymetrix probeset data:

Annotations for 1636589_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime