Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636590_s_at:

>probe:Drosophila_2:1636590_s_at:695:487; Interrogation_Position=1014; Antisense; GTACGACTGGGCCTAATGACTCCAA
>probe:Drosophila_2:1636590_s_at:53:705; Interrogation_Position=1095; Antisense; TTATCTCTATGGTCTCTTGTCAAAC
>probe:Drosophila_2:1636590_s_at:179:47; Interrogation_Position=573; Antisense; ATCCCCGGCGTGAGTTCATGTATAA
>probe:Drosophila_2:1636590_s_at:9:241; Interrogation_Position=608; Antisense; AATACAGTACGCTTACCTGCGTCAA
>probe:Drosophila_2:1636590_s_at:218:621; Interrogation_Position=625; Antisense; TGCGTCAAACAAACATCTCCGAGAG
>probe:Drosophila_2:1636590_s_at:8:271; Interrogation_Position=657; Antisense; CATGAGTTACTTATCTGCGCTGACT
>probe:Drosophila_2:1636590_s_at:268:283; Interrogation_Position=671; Antisense; CTGCGCTGACTACGTTGGCATGGTA
>probe:Drosophila_2:1636590_s_at:429:491; Interrogation_Position=712; Antisense; GTAAAGACTACCTCGGTCGCATACT
>probe:Drosophila_2:1636590_s_at:41:465; Interrogation_Position=766; Antisense; GATTCGCACGGTTCCGATTTTTGGA
>probe:Drosophila_2:1636590_s_at:75:459; Interrogation_Position=781; Antisense; GATTTTTGGAGGACCTTCACCTGAA
>probe:Drosophila_2:1636590_s_at:265:369; Interrogation_Position=803; Antisense; GAAGGCCAGGAACTACACTCTAAGG
>probe:Drosophila_2:1636590_s_at:691:161; Interrogation_Position=914; Antisense; AAATACCCGCGAAGAGGATCACGTA
>probe:Drosophila_2:1636590_s_at:383:493; Interrogation_Position=967; Antisense; GTAATCCAGAAAGCCGCAAGCGCCA
>probe:Drosophila_2:1636590_s_at:343:205; Interrogation_Position=984; Antisense; AAGCGCCATGTTGCCCATCTAATGA

Paste this into a BLAST search page for me
GTACGACTGGGCCTAATGACTCCAATTATCTCTATGGTCTCTTGTCAAACATCCCCGGCGTGAGTTCATGTATAAAATACAGTACGCTTACCTGCGTCAATGCGTCAAACAAACATCTCCGAGAGCATGAGTTACTTATCTGCGCTGACTCTGCGCTGACTACGTTGGCATGGTAGTAAAGACTACCTCGGTCGCATACTGATTCGCACGGTTCCGATTTTTGGAGATTTTTGGAGGACCTTCACCTGAAGAAGGCCAGGAACTACACTCTAAGGAAATACCCGCGAAGAGGATCACGTAGTAATCCAGAAAGCCGCAAGCGCCAAAGCGCCATGTTGCCCATCTAATGA

Full Affymetrix probeset data:

Annotations for 1636590_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime