FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636591_at:

>probe:Drosophila_2:1636591_at:558:85; Interrogation_Position=157; Antisense; AGTGCTCGGAAACGATTCGCATTGC
>probe:Drosophila_2:1636591_at:417:103; Interrogation_Position=202; Antisense; AGAGCGACAACAGTGTGCTGCCGTT
>probe:Drosophila_2:1636591_at:318:517; Interrogation_Position=214; Antisense; GTGTGCTGCCGTTGCCGAATGTCAA
>probe:Drosophila_2:1636591_at:49:231; Interrogation_Position=231; Antisense; AATGTCAACTCGCTGATCCTGAAGA
>probe:Drosophila_2:1636591_at:28:613; Interrogation_Position=250; Antisense; TGAAGAAAGTGCTCCACTGGGCCAC
>probe:Drosophila_2:1636591_at:523:595; Interrogation_Position=267; Antisense; TGGGCCACCTATCACAAGGACGATC
>probe:Drosophila_2:1636591_at:454:73; Interrogation_Position=283; Antisense; AGGACGATCCTGTGGTTACCGAAGA
>probe:Drosophila_2:1636591_at:564:355; Interrogation_Position=328; Antisense; GCACTGATGACATCTCATCCTGGGA
>probe:Drosophila_2:1636591_at:313:45; Interrogation_Position=344; Antisense; ATCCTGGGACGCTGACTTTCTCAAA
>probe:Drosophila_2:1636591_at:230:83; Interrogation_Position=376; Antisense; AGGGCACGCTGTTCGAACTGATCCT
>probe:Drosophila_2:1636591_at:398:631; Interrogation_Position=397; Antisense; TCCTCGCGGCAAACTACCTGAATAT
>probe:Drosophila_2:1636591_at:363:365; Interrogation_Position=416; Antisense; GAATATCCAGGGTCTGCTCGACGTC
>probe:Drosophila_2:1636591_at:343:369; Interrogation_Position=512; Antisense; GAATGACTTTCTGCCACAGGAGGAG
>probe:Drosophila_2:1636591_at:433:37; Interrogation_Position=99; Antisense; ATCATTCGGCTGGAGTCTGCGGACA

Paste this into a BLAST search page for me
AGTGCTCGGAAACGATTCGCATTGCAGAGCGACAACAGTGTGCTGCCGTTGTGTGCTGCCGTTGCCGAATGTCAAAATGTCAACTCGCTGATCCTGAAGATGAAGAAAGTGCTCCACTGGGCCACTGGGCCACCTATCACAAGGACGATCAGGACGATCCTGTGGTTACCGAAGAGCACTGATGACATCTCATCCTGGGAATCCTGGGACGCTGACTTTCTCAAAAGGGCACGCTGTTCGAACTGATCCTTCCTCGCGGCAAACTACCTGAATATGAATATCCAGGGTCTGCTCGACGTCGAATGACTTTCTGCCACAGGAGGAGATCATTCGGCTGGAGTCTGCGGACA

Full Affymetrix probeset data:

Annotations for 1636591_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720