Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636594_at:

>probe:Drosophila_2:1636594_at:616:571; Interrogation_Position=1572; Antisense; GGCTGATTCAACTACCCGGCTGGGC
>probe:Drosophila_2:1636594_at:206:653; Interrogation_Position=1579; Antisense; TCAACTACCCGGCTGGGCCATCTAT
>probe:Drosophila_2:1636594_at:445:333; Interrogation_Position=1590; Antisense; GCTGGGCCATCTATGCCATCTATAA
>probe:Drosophila_2:1636594_at:641:35; Interrogation_Position=1598; Antisense; ATCTATGCCATCTATAAAAAGCGTG
>probe:Drosophila_2:1636594_at:333:183; Interrogation_Position=1614; Antisense; AAAAGCGTGGCCATAACGGCAGCTT
>probe:Drosophila_2:1636594_at:617:119; Interrogation_Position=1617; Antisense; AGCGTGGCCATAACGGCAGCTTCTG
>probe:Drosophila_2:1636594_at:487:307; Interrogation_Position=1624; Antisense; CCATAACGGCAGCTTCTGGCAGAGA
>probe:Drosophila_2:1636594_at:289:197; Interrogation_Position=1628; Antisense; AACGGCAGCTTCTGGCAGAGAATAC
>probe:Drosophila_2:1636594_at:513:263; Interrogation_Position=1643; Antisense; CAGAGAATACGTGCCGCTTGCAAGC
>probe:Drosophila_2:1636594_at:521:365; Interrogation_Position=1647; Antisense; GAATACGTGCCGCTTGCAAGCCGTC
>probe:Drosophila_2:1636594_at:155:343; Interrogation_Position=1658; Antisense; GCTTGCAAGCCGTCGGACACTTGGG
>probe:Drosophila_2:1636594_at:272:553; Interrogation_Position=1682; Antisense; GGACCGGCCAACGTTCAGCTGGATG
>probe:Drosophila_2:1636594_at:580:197; Interrogation_Position=1691; Antisense; AACGTTCAGCTGGATGCCACCATAT
>probe:Drosophila_2:1636594_at:377:293; Interrogation_Position=1693; Antisense; CGTTCAGCTGGATGCCACCATATAG

Paste this into a BLAST search page for me
GGCTGATTCAACTACCCGGCTGGGCTCAACTACCCGGCTGGGCCATCTATGCTGGGCCATCTATGCCATCTATAAATCTATGCCATCTATAAAAAGCGTGAAAAGCGTGGCCATAACGGCAGCTTAGCGTGGCCATAACGGCAGCTTCTGCCATAACGGCAGCTTCTGGCAGAGAAACGGCAGCTTCTGGCAGAGAATACCAGAGAATACGTGCCGCTTGCAAGCGAATACGTGCCGCTTGCAAGCCGTCGCTTGCAAGCCGTCGGACACTTGGGGGACCGGCCAACGTTCAGCTGGATGAACGTTCAGCTGGATGCCACCATATCGTTCAGCTGGATGCCACCATATAG

Full Affymetrix probeset data:

Annotations for 1636594_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime