FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636596_at:

>probe:Drosophila_2:1636596_at:201:169; Interrogation_Position=330; Antisense; AAAGGCGCGCCTCAAGGTAACCAGT
>probe:Drosophila_2:1636596_at:272:539; Interrogation_Position=345; Antisense; GGTAACCAGTCATCTGCTGTACGAA
>probe:Drosophila_2:1636596_at:214:121; Interrogation_Position=370; Antisense; AGCGTCGCCGACAAGATCAACTATG
>probe:Drosophila_2:1636596_at:296:61; Interrogation_Position=392; Antisense; ATGTGACCTTTTTCCGCGACTTCAA
>probe:Drosophila_2:1636596_at:623:711; Interrogation_Position=412; Antisense; TTCAATCTGCCCAATACCTTTAACT
>probe:Drosophila_2:1636596_at:550:383; Interrogation_Position=454; Antisense; GAACTGCATGTTTGGCTACTCCTGA
>probe:Drosophila_2:1636596_at:447:443; Interrogation_Position=559; Antisense; GATGTTAACACACGCGCCAAGAAAT
>probe:Drosophila_2:1636596_at:648:247; Interrogation_Position=581; Antisense; AATTGGGAGCTCACAATCCTTCACG
>probe:Drosophila_2:1636596_at:519:423; Interrogation_Position=622; Antisense; GAGACCTTATCCGAGCAGTTCCAAG
>probe:Drosophila_2:1636596_at:291:137; Interrogation_Position=662; Antisense; ACGACGAGGGCATCATGTCCGACGA
>probe:Drosophila_2:1636596_at:123:323; Interrogation_Position=711; Antisense; GCGCCGCTTCTTCGAGATGAACTGT
>probe:Drosophila_2:1636596_at:587:121; Interrogation_Position=755; Antisense; AGCGACTGGTGAAGTACGTCCGCCA
>probe:Drosophila_2:1636596_at:54:53; Interrogation_Position=790; Antisense; ATGCTGGACAGTTTGCCGCGCGATC
>probe:Drosophila_2:1636596_at:195:323; Interrogation_Position=807; Antisense; GCGCGATCAGTTCATTGTCAAGCCG

Paste this into a BLAST search page for me
AAAGGCGCGCCTCAAGGTAACCAGTGGTAACCAGTCATCTGCTGTACGAAAGCGTCGCCGACAAGATCAACTATGATGTGACCTTTTTCCGCGACTTCAATTCAATCTGCCCAATACCTTTAACTGAACTGCATGTTTGGCTACTCCTGAGATGTTAACACACGCGCCAAGAAATAATTGGGAGCTCACAATCCTTCACGGAGACCTTATCCGAGCAGTTCCAAGACGACGAGGGCATCATGTCCGACGAGCGCCGCTTCTTCGAGATGAACTGTAGCGACTGGTGAAGTACGTCCGCCAATGCTGGACAGTTTGCCGCGCGATCGCGCGATCAGTTCATTGTCAAGCCG

Full Affymetrix probeset data:

Annotations for 1636596_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720