FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636597_at:

>probe:Drosophila_2:1636597_at:65:121; Interrogation_Position=170; Antisense; AGCGAGTCGAGCGTCATTGGCTATC
>probe:Drosophila_2:1636597_at:303:43; Interrogation_Position=192; Antisense; ATCGATGGCCGAAACGCAGTTGCAC
>probe:Drosophila_2:1636597_at:321:469; Interrogation_Position=210; Antisense; GTTGCACAGCCTGATCACAGACGAT
>probe:Drosophila_2:1636597_at:520:161; Interrogation_Position=254; Antisense; ACAATATGCTGGAGACCTGGTCTAC
>probe:Drosophila_2:1636597_at:123:603; Interrogation_Position=363; Antisense; TGTTTTGCTACCCTTGATCCTGAAA
>probe:Drosophila_2:1636597_at:99:47; Interrogation_Position=379; Antisense; ATCCTGAAATGGCTTACGGCGCTTT
>probe:Drosophila_2:1636597_at:382:413; Interrogation_Position=405; Antisense; GACCTCGTCGTTTGTCATGGGCAAA
>probe:Drosophila_2:1636597_at:643:183; Interrogation_Position=427; Antisense; AAAATCGCTTTGGTCACATCCGGTA
>probe:Drosophila_2:1636597_at:538:257; Interrogation_Position=441; Antisense; CACATCCGGTATTTTGGCTCTGAAA
>probe:Drosophila_2:1636597_at:68:153; Interrogation_Position=483; Antisense; ACATGCACACGATCGCCTGGAGATA
>probe:Drosophila_2:1636597_at:275:97; Interrogation_Position=503; Antisense; AGATAATTCACTCTCATGCACCACT
>probe:Drosophila_2:1636597_at:289:267; Interrogation_Position=546; Antisense; CAGTGATTTATCCTCCAGCGGAAGC
>probe:Drosophila_2:1636597_at:249:377; Interrogation_Position=566; Antisense; GAAGCAGTTGGATGCCCATTCGACA
>probe:Drosophila_2:1636597_at:289:11; Interrogation_Position=583; Antisense; ATTCGACAGCCCTTTATACCATTGG

Paste this into a BLAST search page for me
AGCGAGTCGAGCGTCATTGGCTATCATCGATGGCCGAAACGCAGTTGCACGTTGCACAGCCTGATCACAGACGATACAATATGCTGGAGACCTGGTCTACTGTTTTGCTACCCTTGATCCTGAAAATCCTGAAATGGCTTACGGCGCTTTGACCTCGTCGTTTGTCATGGGCAAAAAAATCGCTTTGGTCACATCCGGTACACATCCGGTATTTTGGCTCTGAAAACATGCACACGATCGCCTGGAGATAAGATAATTCACTCTCATGCACCACTCAGTGATTTATCCTCCAGCGGAAGCGAAGCAGTTGGATGCCCATTCGACAATTCGACAGCCCTTTATACCATTGG

Full Affymetrix probeset data:

Annotations for 1636597_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720