FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636599_at:

>probe:Drosophila_2:1636599_at:176:7; Interrogation_Position=1015; Antisense; ATTGACGAGCGCACTGACATATGGA
>probe:Drosophila_2:1636599_at:103:89; Interrogation_Position=1039; Antisense; AGTCTTGGCTGTGTGCTCTATGCAA
>probe:Drosophila_2:1636599_at:220:619; Interrogation_Position=1066; Antisense; TGCTACTTTAATTCACCCTACGATC
>probe:Drosophila_2:1636599_at:95:671; Interrogation_Position=1084; Antisense; TACGATCCCATCTACGAGCGAGGTG
>probe:Drosophila_2:1636599_at:323:141; Interrogation_Position=1221; Antisense; ACGGCCATTCGTGTTTAGTGTTATC
>probe:Drosophila_2:1636599_at:24:395; Interrogation_Position=1246; Antisense; GAAAGGACCCACGATCTGATACAGA
>probe:Drosophila_2:1636599_at:349:389; Interrogation_Position=1269; Antisense; GAAACTGGAGGGTCGCTTGTAGCTC
>probe:Drosophila_2:1636599_at:30:273; Interrogation_Position=1284; Antisense; CTTGTAGCTCCCACTAACTGGATTA
>probe:Drosophila_2:1636599_at:663:455; Interrogation_Position=1339; Antisense; GATACACCGCTTACTGTTTTTTGAC
>probe:Drosophila_2:1636599_at:672:623; Interrogation_Position=844; Antisense; TGCCTGTCGGACTCTTTTGAGCCAA
>probe:Drosophila_2:1636599_at:624:3; Interrogation_Position=910; Antisense; ATTGTGGGCCAGACGGATGCTCAGC
>probe:Drosophila_2:1636599_at:210:447; Interrogation_Position=925; Antisense; GATGCTCAGCGCTTGCAGGACGAAG
>probe:Drosophila_2:1636599_at:668:425; Interrogation_Position=955; Antisense; GAGAGGAGCTCCATTGTCTACCGGG
>probe:Drosophila_2:1636599_at:347:523; Interrogation_Position=977; Antisense; GGGCTCCAGAGTTATTTACCGTGAA

Paste this into a BLAST search page for me
ATTGACGAGCGCACTGACATATGGAAGTCTTGGCTGTGTGCTCTATGCAATGCTACTTTAATTCACCCTACGATCTACGATCCCATCTACGAGCGAGGTGACGGCCATTCGTGTTTAGTGTTATCGAAAGGACCCACGATCTGATACAGAGAAACTGGAGGGTCGCTTGTAGCTCCTTGTAGCTCCCACTAACTGGATTAGATACACCGCTTACTGTTTTTTGACTGCCTGTCGGACTCTTTTGAGCCAAATTGTGGGCCAGACGGATGCTCAGCGATGCTCAGCGCTTGCAGGACGAAGGAGAGGAGCTCCATTGTCTACCGGGGGGCTCCAGAGTTATTTACCGTGAA

Full Affymetrix probeset data:

Annotations for 1636599_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720