Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636600_a_at:

>probe:Drosophila_2:1636600_a_at:207:729; Interrogation_Position=152; Antisense; TTGGGCGCAATGAGAGCCCCAGCAA
>probe:Drosophila_2:1636600_a_at:41:371; Interrogation_Position=177; Antisense; GAAGGCGAAATTCTGGCAGTCCTAC
>probe:Drosophila_2:1636600_a_at:533:349; Interrogation_Position=192; Antisense; GCAGTCCTACATCAGGTCCCTGAAG
>probe:Drosophila_2:1636600_a_at:478:615; Interrogation_Position=212; Antisense; TGAAGGGCTCCGAGGATATCCGTGC
>probe:Drosophila_2:1636600_a_at:668:153; Interrogation_Position=293; Antisense; ACAGGAGCATCTATGACGAGCCCGC
>probe:Drosophila_2:1636600_a_at:505:87; Interrogation_Position=338; Antisense; AGTCCTCTGGCTACAGATATCTGCC
>probe:Drosophila_2:1636600_a_at:696:95; Interrogation_Position=352; Antisense; AGATATCTGCCAGTGAGCCGCGACA
>probe:Drosophila_2:1636600_a_at:590:671; Interrogation_Position=403; Antisense; TACGATCATCACTACAGCCGAACAA
>probe:Drosophila_2:1636600_a_at:424:563; Interrogation_Position=437; Antisense; GGAATGATCATCTGAAGCGCATGCA
>probe:Drosophila_2:1636600_a_at:112:551; Interrogation_Position=462; Antisense; GGAGATCGAGCGCAGGTACCCATCT
>probe:Drosophila_2:1636600_a_at:617:37; Interrogation_Position=483; Antisense; ATCTCGCTATGGTCTCTACTTGAGG
>probe:Drosophila_2:1636600_a_at:405:667; Interrogation_Position=499; Antisense; TACTTGAGGGACAAGCCACTCACGC
>probe:Drosophila_2:1636600_a_at:46:91; Interrogation_Position=545; Antisense; AGTACGAGCCAGAGGACAAGCTGCT
>probe:Drosophila_2:1636600_a_at:259:161; Interrogation_Position=560; Antisense; ACAAGCTGCTGGCTGAGCTCAACAA

Paste this into a BLAST search page for me
TTGGGCGCAATGAGAGCCCCAGCAAGAAGGCGAAATTCTGGCAGTCCTACGCAGTCCTACATCAGGTCCCTGAAGTGAAGGGCTCCGAGGATATCCGTGCACAGGAGCATCTATGACGAGCCCGCAGTCCTCTGGCTACAGATATCTGCCAGATATCTGCCAGTGAGCCGCGACATACGATCATCACTACAGCCGAACAAGGAATGATCATCTGAAGCGCATGCAGGAGATCGAGCGCAGGTACCCATCTATCTCGCTATGGTCTCTACTTGAGGTACTTGAGGGACAAGCCACTCACGCAGTACGAGCCAGAGGACAAGCTGCTACAAGCTGCTGGCTGAGCTCAACAA

Full Affymetrix probeset data:

Annotations for 1636600_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime