FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636604_at:

>probe:Drosophila_2:1636604_at:25:351; Interrogation_Position=1017; Antisense; GCAGAAGAACCTGGCAATTGCTTTG
>probe:Drosophila_2:1636604_at:110:527; Interrogation_Position=1134; Antisense; GGGAATCTTGAATACGGCTGTTACT
>probe:Drosophila_2:1636604_at:696:139; Interrogation_Position=1147; Antisense; ACGGCTGTTACTGTAGTGCCTATAG
>probe:Drosophila_2:1636604_at:410:3; Interrogation_Position=1168; Antisense; ATAGTAACCCCTTTGATTGTTGGAG
>probe:Drosophila_2:1636604_at:34:213; Interrogation_Position=1205; Antisense; AAGACGATAACCGTGCTGAGTGGCA
>probe:Drosophila_2:1636604_at:39:335; Interrogation_Position=1219; Antisense; GCTGAGTGGCAGATAGTGTTCATAA
>probe:Drosophila_2:1636604_at:614:679; Interrogation_Position=1261; Antisense; TTTGTCGGAAACTCGGTGTACCTAT
>probe:Drosophila_2:1636604_at:583:487; Interrogation_Position=1278; Antisense; GTACCTATACTTTGGAACGGCTGTT
>probe:Drosophila_2:1636604_at:700:673; Interrogation_Position=1327; Antisense; TACCTCACAGTAAAGGTGCCAGAGC
>probe:Drosophila_2:1636604_at:572:505; Interrogation_Position=1342; Antisense; GTGCCAGAGCTAGCTAAAGTTCCAG
>probe:Drosophila_2:1636604_at:48:607; Interrogation_Position=1392; Antisense; TGATGACCTTCCACGAAGTCCTTGA
>probe:Drosophila_2:1636604_at:157:639; Interrogation_Position=877; Antisense; TCGTATGTGTACCTGATAATCGCCG
>probe:Drosophila_2:1636604_at:469:515; Interrogation_Position=883; Antisense; GTGTACCTGATAATCGCCGATGTTC
>probe:Drosophila_2:1636604_at:382:1; Interrogation_Position=939; Antisense; CCTCCGGAAGACCTTCAACTCGTTG

Paste this into a BLAST search page for me
GCAGAAGAACCTGGCAATTGCTTTGGGGAATCTTGAATACGGCTGTTACTACGGCTGTTACTGTAGTGCCTATAGATAGTAACCCCTTTGATTGTTGGAGAAGACGATAACCGTGCTGAGTGGCAGCTGAGTGGCAGATAGTGTTCATAATTTGTCGGAAACTCGGTGTACCTATGTACCTATACTTTGGAACGGCTGTTTACCTCACAGTAAAGGTGCCAGAGCGTGCCAGAGCTAGCTAAAGTTCCAGTGATGACCTTCCACGAAGTCCTTGATCGTATGTGTACCTGATAATCGCCGGTGTACCTGATAATCGCCGATGTTCCCTCCGGAAGACCTTCAACTCGTTG

Full Affymetrix probeset data:

Annotations for 1636604_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720