FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636605_at:

>probe:Drosophila_2:1636605_at:644:523; Interrogation_Position=114; Antisense; GGGCGGCCTCCAAGAGAGTGAAACT
>probe:Drosophila_2:1636605_at:220:433; Interrogation_Position=129; Antisense; GAGTGAAACTATGCCTGCAGCCCAT
>probe:Drosophila_2:1636605_at:105:617; Interrogation_Position=144; Antisense; TGCAGCCCATGATCAGTGGTCGGTG
>probe:Drosophila_2:1636605_at:3:635; Interrogation_Position=156; Antisense; TCAGTGGTCGGTGCTTTGGATACGT
>probe:Drosophila_2:1636605_at:29:543; Interrogation_Position=173; Antisense; GGATACGTTGAGAGCTATGCCTACA
>probe:Drosophila_2:1636605_at:378:417; Interrogation_Position=184; Antisense; GAGCTATGCCTACAATCCCATTAAG
>probe:Drosophila_2:1636605_at:433:709; Interrogation_Position=204; Antisense; TTAAGCGCCATTGCGAACCCTTCAT
>probe:Drosophila_2:1636605_at:91:51; Interrogation_Position=238; Antisense; ATGCGGCGGTAATGACAATCGATTT
>probe:Drosophila_2:1636605_at:565:459; Interrogation_Position=258; Antisense; GATTTAGTACCAAAGCTGAGTGCGA
>probe:Drosophila_2:1636605_at:318:433; Interrogation_Position=275; Antisense; GAGTGCGAGTTCAACTGCCGTGATA
>probe:Drosophila_2:1636605_at:643:533; Interrogation_Position=33; Antisense; GGTCTGAGCATTTGAAGGCATTTCC
>probe:Drosophila_2:1636605_at:661:71; Interrogation_Position=48; Antisense; AGGCATTTCCGGCTTATTGGCAGTG
>probe:Drosophila_2:1636605_at:437:3; Interrogation_Position=63; Antisense; ATTGGCAGTGGCTTTTGGTTGGCCT
>probe:Drosophila_2:1636605_at:248:283; Interrogation_Position=89; Antisense; CTCCTGTTGATTCCGCACCATTCAG

Paste this into a BLAST search page for me
GGGCGGCCTCCAAGAGAGTGAAACTGAGTGAAACTATGCCTGCAGCCCATTGCAGCCCATGATCAGTGGTCGGTGTCAGTGGTCGGTGCTTTGGATACGTGGATACGTTGAGAGCTATGCCTACAGAGCTATGCCTACAATCCCATTAAGTTAAGCGCCATTGCGAACCCTTCATATGCGGCGGTAATGACAATCGATTTGATTTAGTACCAAAGCTGAGTGCGAGAGTGCGAGTTCAACTGCCGTGATAGGTCTGAGCATTTGAAGGCATTTCCAGGCATTTCCGGCTTATTGGCAGTGATTGGCAGTGGCTTTTGGTTGGCCTCTCCTGTTGATTCCGCACCATTCAG

Full Affymetrix probeset data:

Annotations for 1636605_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720