FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636606_at:

>probe:Drosophila_2:1636606_at:114:281; Interrogation_Position=1424; Antisense; CTCGCTGTCCATGCAGGGAGGATTC
>probe:Drosophila_2:1636606_at:72:585; Interrogation_Position=1450; Antisense; TGGACTCCTTGGCATTTGCTACAGA
>probe:Drosophila_2:1636606_at:718:21; Interrogation_Position=1495; Antisense; ATATGGTTGTGCTTTCCGTTTGTTC
>probe:Drosophila_2:1636606_at:212:263; Interrogation_Position=1519; Antisense; CAGCGGTCGGACAATTGTTTATCTA
>probe:Drosophila_2:1636606_at:288:665; Interrogation_Position=1547; Antisense; TACAATTGATGTCTTCGGCCCAGTT
>probe:Drosophila_2:1636606_at:522:279; Interrogation_Position=1562; Antisense; CGGCCCAGTTGTGTTTACGATAATA
>probe:Drosophila_2:1636606_at:296:655; Interrogation_Position=1585; Antisense; TAATGACACTGCGTCAGGCGGTGGC
>probe:Drosophila_2:1636606_at:139:117; Interrogation_Position=1641; Antisense; AGCATATCGCTGTTGGGCATCTTCG
>probe:Drosophila_2:1636606_at:9:535; Interrogation_Position=1665; Antisense; GGTGTTCTGATCGTTTTCGTTGCCA
>probe:Drosophila_2:1636606_at:703:637; Interrogation_Position=1681; Antisense; TCGTTGCCATCTTCCTGAGGGTCTA
>probe:Drosophila_2:1636606_at:529:485; Interrogation_Position=1781; Antisense; GTAGACTCCCTTCGAATACAACGCA
>probe:Drosophila_2:1636606_at:171:279; Interrogation_Position=1814; Antisense; CTAGCTCAGCCTTTTATTGTGCTCA
>probe:Drosophila_2:1636606_at:701:505; Interrogation_Position=1832; Antisense; GTGCTCATAGTAACCCATGGCAGAT
>probe:Drosophila_2:1636606_at:142:379; Interrogation_Position=1878; Antisense; GAAGCTGCTCGGACTCTCCAAAAAT

Paste this into a BLAST search page for me
CTCGCTGTCCATGCAGGGAGGATTCTGGACTCCTTGGCATTTGCTACAGAATATGGTTGTGCTTTCCGTTTGTTCCAGCGGTCGGACAATTGTTTATCTATACAATTGATGTCTTCGGCCCAGTTCGGCCCAGTTGTGTTTACGATAATATAATGACACTGCGTCAGGCGGTGGCAGCATATCGCTGTTGGGCATCTTCGGGTGTTCTGATCGTTTTCGTTGCCATCGTTGCCATCTTCCTGAGGGTCTAGTAGACTCCCTTCGAATACAACGCACTAGCTCAGCCTTTTATTGTGCTCAGTGCTCATAGTAACCCATGGCAGATGAAGCTGCTCGGACTCTCCAAAAAT

Full Affymetrix probeset data:

Annotations for 1636606_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720