Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636607_at:

>probe:Drosophila_2:1636607_at:568:653; Interrogation_Position=1650; Antisense; TAATTAACGGCGATTGCTAAGACAA
>probe:Drosophila_2:1636607_at:560:481; Interrogation_Position=1722; Antisense; GTATTTGCCCAACACAATGCGGAAT
>probe:Drosophila_2:1636607_at:613:637; Interrogation_Position=1791; Antisense; TCGGTACTTACCTTGGGTTCATTAG
>probe:Drosophila_2:1636607_at:423:673; Interrogation_Position=1799; Antisense; TACCTTGGGTTCATTAGCGTTTAAT
>probe:Drosophila_2:1636607_at:403:245; Interrogation_Position=1843; Antisense; AATTAGTTTTTTGGTGTCTAGATGA
>probe:Drosophila_2:1636607_at:400:435; Interrogation_Position=1937; Antisense; GAGGTCAGACAAATAATTACGCATT
>probe:Drosophila_2:1636607_at:369:659; Interrogation_Position=1954; Antisense; TACGCATTAGTGTAGTTTTAACCCT
>probe:Drosophila_2:1636607_at:264:437; Interrogation_Position=1992; Antisense; GAGGCTTTCGGTAGATAATTGTTGA
>probe:Drosophila_2:1636607_at:394:229; Interrogation_Position=2041; Antisense; AATGGTGAATCCTTTTTTGTTTATG
>probe:Drosophila_2:1636607_at:11:491; Interrogation_Position=2065; Antisense; GTACATATTTCCTAAAGTGTTCGGA
>probe:Drosophila_2:1636607_at:277:513; Interrogation_Position=2081; Antisense; GTGTTCGGAATTAACAATTTCCACT
>probe:Drosophila_2:1636607_at:413:249; Interrogation_Position=2095; Antisense; CAATTTCCACTTTCTATGTCGGCTA
>probe:Drosophila_2:1636607_at:605:257; Interrogation_Position=2102; Antisense; CACTTTCTATGTCGGCTATAGGGAT
>probe:Drosophila_2:1636607_at:410:529; Interrogation_Position=2122; Antisense; GGGATATAGTGTCGCATTTACTTAA

Paste this into a BLAST search page for me
TAATTAACGGCGATTGCTAAGACAAGTATTTGCCCAACACAATGCGGAATTCGGTACTTACCTTGGGTTCATTAGTACCTTGGGTTCATTAGCGTTTAATAATTAGTTTTTTGGTGTCTAGATGAGAGGTCAGACAAATAATTACGCATTTACGCATTAGTGTAGTTTTAACCCTGAGGCTTTCGGTAGATAATTGTTGAAATGGTGAATCCTTTTTTGTTTATGGTACATATTTCCTAAAGTGTTCGGAGTGTTCGGAATTAACAATTTCCACTCAATTTCCACTTTCTATGTCGGCTACACTTTCTATGTCGGCTATAGGGATGGGATATAGTGTCGCATTTACTTAA

Full Affymetrix probeset data:

Annotations for 1636607_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime