FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636610_at:

>probe:Drosophila_2:1636610_at:491:153; Interrogation_Position=1026; Antisense; ACATGTCAGCACACACGCGAGGGAA
>probe:Drosophila_2:1636610_at:363:379; Interrogation_Position=1048; Antisense; GAAGCGACGGACGAGCAGCCAAGAA
>probe:Drosophila_2:1636610_at:161:341; Interrogation_Position=1167; Antisense; GCTAGTAATCGCAACCAAAGTGAGA
>probe:Drosophila_2:1636610_at:40:183; Interrogation_Position=1202; Antisense; AAAACTGTTGTGAATCGATCCGATT
>probe:Drosophila_2:1636610_at:379:449; Interrogation_Position=1218; Antisense; GATCCGATTATCATTTCTTTATTAT
>probe:Drosophila_2:1636610_at:354:679; Interrogation_Position=1307; Antisense; TAGTCGCTAACTTGTTTCTACTTTA
>probe:Drosophila_2:1636610_at:645:461; Interrogation_Position=769; Antisense; GATTCACATGCGCATACATACTGGC
>probe:Drosophila_2:1636610_at:642:665; Interrogation_Position=803; Antisense; TACAAGTGCTCCCTATGTCCGCGAT
>probe:Drosophila_2:1636610_at:135:619; Interrogation_Position=849; Antisense; TGCAGAGCCACACACGTTGTCACAC
>probe:Drosophila_2:1636610_at:604:183; Interrogation_Position=908; Antisense; AAGCGCTTCCGGCAAGTTGGGCAAC
>probe:Drosophila_2:1636610_at:584:93; Interrogation_Position=922; Antisense; AGTTGGGCAACTGCAAGTCCACACC
>probe:Drosophila_2:1636610_at:471:129; Interrogation_Position=944; Antisense; ACCCGGACTCATACTGGCGAACAGC
>probe:Drosophila_2:1636610_at:612:125; Interrogation_Position=966; Antisense; AGCCGTTCAAATGTTCCAAATGTCA
>probe:Drosophila_2:1636610_at:269:341; Interrogation_Position=996; Antisense; GCTTCAAGCAACTAAACGGCCTACA

Paste this into a BLAST search page for me
ACATGTCAGCACACACGCGAGGGAAGAAGCGACGGACGAGCAGCCAAGAAGCTAGTAATCGCAACCAAAGTGAGAAAAACTGTTGTGAATCGATCCGATTGATCCGATTATCATTTCTTTATTATTAGTCGCTAACTTGTTTCTACTTTAGATTCACATGCGCATACATACTGGCTACAAGTGCTCCCTATGTCCGCGATTGCAGAGCCACACACGTTGTCACACAAGCGCTTCCGGCAAGTTGGGCAACAGTTGGGCAACTGCAAGTCCACACCACCCGGACTCATACTGGCGAACAGCAGCCGTTCAAATGTTCCAAATGTCAGCTTCAAGCAACTAAACGGCCTACA

Full Affymetrix probeset data:

Annotations for 1636610_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720