FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636611_at:

>probe:Drosophila_2:1636611_at:535:545; Interrogation_Position=339; Antisense; GGATCTGCGATACTCTTATCCAAAG
>probe:Drosophila_2:1636611_at:524:169; Interrogation_Position=360; Antisense; AAAGTTCGTATTGGCTCCTCGCGGA
>probe:Drosophila_2:1636611_at:642:121; Interrogation_Position=415; Antisense; AGCGAGTTCATCGACATCCCAAATT
>probe:Drosophila_2:1636611_at:300:611; Interrogation_Position=455; Antisense; TGACTTTGACTTTTCGCTGCTCGAA
>probe:Drosophila_2:1636611_at:127:505; Interrogation_Position=493; Antisense; GTGCCAAGAACGTGACGCAGGCTTT
>probe:Drosophila_2:1636611_at:210:687; Interrogation_Position=515; Antisense; TTTCGTTGGGCTTCCCGAACAGGAT
>probe:Drosophila_2:1636611_at:535:557; Interrogation_Position=542; Antisense; GGACATTGCCGATGGTACACCGGTC
>probe:Drosophila_2:1636611_at:195:475; Interrogation_Position=627; Antisense; GTTACGGTGCCCAAAGTCAGTCAGA
>probe:Drosophila_2:1636611_at:184:495; Interrogation_Position=646; Antisense; GTCAGACGCAGTGCACAGAGGCTTA
>probe:Drosophila_2:1636611_at:518:155; Interrogation_Position=660; Antisense; ACAGAGGCTTATGGCAACTTTGGCA
>probe:Drosophila_2:1636611_at:10:193; Interrogation_Position=675; Antisense; AACTTTGGCAGCATCACGGATCGCA
>probe:Drosophila_2:1636611_at:174:465; Interrogation_Position=808; Antisense; GTTGTGCTAGACCAAACTATCCCGG
>probe:Drosophila_2:1636611_at:641:621; Interrogation_Position=851; Antisense; TGCGGTTCGTGACTGGATTAGCTCT
>probe:Drosophila_2:1636611_at:459:461; Interrogation_Position=866; Antisense; GATTAGCTCTGTTAGTGGCATTTGA

Paste this into a BLAST search page for me
GGATCTGCGATACTCTTATCCAAAGAAAGTTCGTATTGGCTCCTCGCGGAAGCGAGTTCATCGACATCCCAAATTTGACTTTGACTTTTCGCTGCTCGAAGTGCCAAGAACGTGACGCAGGCTTTTTTCGTTGGGCTTCCCGAACAGGATGGACATTGCCGATGGTACACCGGTCGTTACGGTGCCCAAAGTCAGTCAGAGTCAGACGCAGTGCACAGAGGCTTAACAGAGGCTTATGGCAACTTTGGCAAACTTTGGCAGCATCACGGATCGCAGTTGTGCTAGACCAAACTATCCCGGTGCGGTTCGTGACTGGATTAGCTCTGATTAGCTCTGTTAGTGGCATTTGA

Full Affymetrix probeset data:

Annotations for 1636611_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720