FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636615_at:

>probe:Drosophila_2:1636615_at:629:537; Interrogation_Position=1925; Antisense; GGTCAGCTTCAAGACCAACAAAGCC
>probe:Drosophila_2:1636615_at:115:203; Interrogation_Position=1945; Antisense; AAGCCAAGTAGAGCGGCCCAAATGG
>probe:Drosophila_2:1636615_at:38:361; Interrogation_Position=1999; Antisense; GCAACCACAACCCATTATCTTGAAT
>probe:Drosophila_2:1636615_at:584:35; Interrogation_Position=2015; Antisense; ATCTTGAATCTAAACCTGACCACAC
>probe:Drosophila_2:1636615_at:229:539; Interrogation_Position=2063; Antisense; GGTATAACGGTAACTAAGCGCAACA
>probe:Drosophila_2:1636615_at:422:565; Interrogation_Position=2133; Antisense; GGCAGGAGAAAATACTCTTTCCACT
>probe:Drosophila_2:1636615_at:564:399; Interrogation_Position=2145; Antisense; TACTCTTTCCACTAAACGACAACGA
>probe:Drosophila_2:1636615_at:311:133; Interrogation_Position=2212; Antisense; ACCGCCGGCCAAAAGCGTTGCAATA
>probe:Drosophila_2:1636615_at:292:389; Interrogation_Position=2237; Antisense; GAAAAATTCTTCTTGTTTAGCATTT
>probe:Drosophila_2:1636615_at:444:197; Interrogation_Position=2270; Antisense; AACCTTAACTAAACGAAGCGAGCAG
>probe:Drosophila_2:1636615_at:626:181; Interrogation_Position=2378; Antisense; AAAACACACTGTGGCAGTGGCAGCT
>probe:Drosophila_2:1636615_at:90:349; Interrogation_Position=2391; Antisense; GCAGTGGCAGCTGTGAAAGGTCAAA
>probe:Drosophila_2:1636615_at:143:493; Interrogation_Position=2410; Antisense; GTCAAAGGTTGGCACAGTCGATCTA
>probe:Drosophila_2:1636615_at:20:567; Interrogation_Position=2420; Antisense; GGCACAGTCGATCTAGTCACAAAGC

Paste this into a BLAST search page for me
GGTCAGCTTCAAGACCAACAAAGCCAAGCCAAGTAGAGCGGCCCAAATGGGCAACCACAACCCATTATCTTGAATATCTTGAATCTAAACCTGACCACACGGTATAACGGTAACTAAGCGCAACAGGCAGGAGAAAATACTCTTTCCACTTACTCTTTCCACTAAACGACAACGAACCGCCGGCCAAAAGCGTTGCAATAGAAAAATTCTTCTTGTTTAGCATTTAACCTTAACTAAACGAAGCGAGCAGAAAACACACTGTGGCAGTGGCAGCTGCAGTGGCAGCTGTGAAAGGTCAAAGTCAAAGGTTGGCACAGTCGATCTAGGCACAGTCGATCTAGTCACAAAGC

Full Affymetrix probeset data:

Annotations for 1636615_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720