Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636616_at:

>probe:Drosophila_2:1636616_at:630:513; Interrogation_Position=1027; Antisense; GTGTACTGCTACAATGGCCAGCGAT
>probe:Drosophila_2:1636616_at:41:121; Interrogation_Position=1063; Antisense; AGCGAGGAGATTGCCAACGCCTTTT
>probe:Drosophila_2:1636616_at:430:199; Interrogation_Position=1078; Antisense; AACGCCTTTTACCAGGTGCGATGGT
>probe:Drosophila_2:1636616_at:697:585; Interrogation_Position=1172; Antisense; TGGACGTGTCCTGGTTCATGCAAAT
>probe:Drosophila_2:1636616_at:435:257; Interrogation_Position=1206; Antisense; CACACTGATGGCGATGGTCCGGACA
>probe:Drosophila_2:1636616_at:222:221; Interrogation_Position=1230; Antisense; AAGTGGACAGTACTTCCTGCTGCTG
>probe:Drosophila_2:1636616_at:721:597; Interrogation_Position=719; Antisense; TGTGCCTTCATAGCGTGGGACTTAT
>probe:Drosophila_2:1636616_at:411:203; Interrogation_Position=770; Antisense; AAGCCACATCTGAGTTGGTTCCTCC
>probe:Drosophila_2:1636616_at:684:539; Interrogation_Position=786; Antisense; GGTTCCTCCAGATCGCAGGGTTGAA
>probe:Drosophila_2:1636616_at:511:83; Interrogation_Position=843; Antisense; AGTGGCGAACTTTGCAACCGAGGTT
>probe:Drosophila_2:1636616_at:182:541; Interrogation_Position=864; Antisense; GGTTAACAACTGCTTTCGGCACATC
>probe:Drosophila_2:1636616_at:246:287; Interrogation_Position=928; Antisense; CTGGCCTTGTTCCAAATGAGCGTCG
>probe:Drosophila_2:1636616_at:651:229; Interrogation_Position=942; Antisense; AATGAGCGTCGGATTGGGCAACAAC
>probe:Drosophila_2:1636616_at:127:59; Interrogation_Position=979; Antisense; ATGATCCGGATGACCATGTACCTGG

Paste this into a BLAST search page for me
GTGTACTGCTACAATGGCCAGCGATAGCGAGGAGATTGCCAACGCCTTTTAACGCCTTTTACCAGGTGCGATGGTTGGACGTGTCCTGGTTCATGCAAATCACACTGATGGCGATGGTCCGGACAAAGTGGACAGTACTTCCTGCTGCTGTGTGCCTTCATAGCGTGGGACTTATAAGCCACATCTGAGTTGGTTCCTCCGGTTCCTCCAGATCGCAGGGTTGAAAGTGGCGAACTTTGCAACCGAGGTTGGTTAACAACTGCTTTCGGCACATCCTGGCCTTGTTCCAAATGAGCGTCGAATGAGCGTCGGATTGGGCAACAACATGATCCGGATGACCATGTACCTGG

Full Affymetrix probeset data:

Annotations for 1636616_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime