Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636618_at:

>probe:Drosophila_2:1636618_at:476:709; Interrogation_Position=149; Antisense; TTAAGGATCTCTACGCCGCCGAGTT
>probe:Drosophila_2:1636618_at:41:293; Interrogation_Position=201; Antisense; CGTCGAGCAGTTCGGCTTCATTGGA
>probe:Drosophila_2:1636618_at:515:343; Interrogation_Position=215; Antisense; GCTTCATTGGATCGTGCCGCAAGAT
>probe:Drosophila_2:1636618_at:368:361; Interrogation_Position=233; Antisense; GCAAGATTCTGTGGGCCGGATACAA
>probe:Drosophila_2:1636618_at:31:161; Interrogation_Position=254; Antisense; ACAAGGGCATCAACGGCACCAAGTG
>probe:Drosophila_2:1636618_at:60:671; Interrogation_Position=322; Antisense; TACGTAGACGACCTGAGCACCTGCA
>probe:Drosophila_2:1636618_at:269:617; Interrogation_Position=343; Antisense; TGCACCGGCGATATTCCCAAGGATA
>probe:Drosophila_2:1636618_at:606:543; Interrogation_Position=363; Antisense; GGATATCCAGGCCATGCTGAACAAT
>probe:Drosophila_2:1636618_at:76:191; Interrogation_Position=424; Antisense; AACATGAAGTCCGAGCTGTGCGCCT
>probe:Drosophila_2:1636618_at:641:101; Interrogation_Position=479; Antisense; AGAGCTTCATGCGTTGCACCCTGAA
>probe:Drosophila_2:1636618_at:450:727; Interrogation_Position=527; Antisense; TTGTCCGCCGCATGAACACATTGAT
>probe:Drosophila_2:1636618_at:98:151; Interrogation_Position=544; Antisense; ACATTGATCAAGCAGGGCGCAGCCC
>probe:Drosophila_2:1636618_at:181:311; Interrogation_Position=605; Antisense; CCAAGAAGGTGGTCGACGGCTGCAA
>probe:Drosophila_2:1636618_at:188:507; Interrogation_Position=637; Antisense; GTGCCCAACATCAATACCTGCATAG

Paste this into a BLAST search page for me
TTAAGGATCTCTACGCCGCCGAGTTCGTCGAGCAGTTCGGCTTCATTGGAGCTTCATTGGATCGTGCCGCAAGATGCAAGATTCTGTGGGCCGGATACAAACAAGGGCATCAACGGCACCAAGTGTACGTAGACGACCTGAGCACCTGCATGCACCGGCGATATTCCCAAGGATAGGATATCCAGGCCATGCTGAACAATAACATGAAGTCCGAGCTGTGCGCCTAGAGCTTCATGCGTTGCACCCTGAATTGTCCGCCGCATGAACACATTGATACATTGATCAAGCAGGGCGCAGCCCCCAAGAAGGTGGTCGACGGCTGCAAGTGCCCAACATCAATACCTGCATAG

Full Affymetrix probeset data:

Annotations for 1636618_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime