FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636622_at:

>probe:Drosophila_2:1636622_at:671:507; Interrogation_Position=100; Antisense; GTGCGATCCCAATTCTGACAACCAG
>probe:Drosophila_2:1636622_at:19:327; Interrogation_Position=135; Antisense; GCGACGCATCCAACGTGCAAACGAA
>probe:Drosophila_2:1636622_at:436:197; Interrogation_Position=154; Antisense; AACGAACATCCGCAACTTCTGGGAT
>probe:Drosophila_2:1636622_at:583:593; Interrogation_Position=17; Antisense; TGGGAACTCAATTGCACCATGAAGT
>probe:Drosophila_2:1636622_at:551:593; Interrogation_Position=173; Antisense; TGGGATCCCACTCGCTACTGGTGGT
>probe:Drosophila_2:1636622_at:265:299; Interrogation_Position=185; Antisense; CGCTACTGGTGGTGTGAGTCCTCCA
>probe:Drosophila_2:1636622_at:426:603; Interrogation_Position=228; Antisense; TGTTGTGCCCGTTGTCCACTGGATT
>probe:Drosophila_2:1636622_at:87:543; Interrogation_Position=248; Antisense; GGATTCGACCCCACAAAGAAGGAGT
>probe:Drosophila_2:1636622_at:711:711; Interrogation_Position=277; Antisense; TTCATGGAGCGAATGGTCTTGGACT
>probe:Drosophila_2:1636622_at:355:497; Interrogation_Position=292; Antisense; GTCTTGGACTGCTTACTGTTGATTG
>probe:Drosophila_2:1636622_at:81:615; Interrogation_Position=36; Antisense; TGAAGTCCGCACTACTTTTGATCTG
>probe:Drosophila_2:1636622_at:536:721; Interrogation_Position=53; Antisense; TTGATCTGCCTTGCCTTCTTCGTGG
>probe:Drosophila_2:1636622_at:513:521; Interrogation_Position=74; Antisense; GTGGCGCTCCTAAGCACCGGAAATG
>probe:Drosophila_2:1636622_at:108:131; Interrogation_Position=89; Antisense; ACCGGAAATGCGTGCGATCCCAATT

Paste this into a BLAST search page for me
GTGCGATCCCAATTCTGACAACCAGGCGACGCATCCAACGTGCAAACGAAAACGAACATCCGCAACTTCTGGGATTGGGAACTCAATTGCACCATGAAGTTGGGATCCCACTCGCTACTGGTGGTCGCTACTGGTGGTGTGAGTCCTCCATGTTGTGCCCGTTGTCCACTGGATTGGATTCGACCCCACAAAGAAGGAGTTTCATGGAGCGAATGGTCTTGGACTGTCTTGGACTGCTTACTGTTGATTGTGAAGTCCGCACTACTTTTGATCTGTTGATCTGCCTTGCCTTCTTCGTGGGTGGCGCTCCTAAGCACCGGAAATGACCGGAAATGCGTGCGATCCCAATT

Full Affymetrix probeset data:

Annotations for 1636622_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720