FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636623_at:

>probe:Drosophila_2:1636623_at:416:223; Interrogation_Position=1543; Antisense; AAGGACTATAACTGCGCTTACTGGG
>probe:Drosophila_2:1636623_at:350:523; Interrogation_Position=1566; Antisense; GGGCCTCCAGGACAAATTCGCCGGA
>probe:Drosophila_2:1636623_at:134:321; Interrogation_Position=1596; Antisense; GCCGCCATTACAACGTCTTAACAAG
>probe:Drosophila_2:1636623_at:290:163; Interrogation_Position=1681; Antisense; AAATTCCTGGCCGAGATCCTGGGAT
>probe:Drosophila_2:1636623_at:494:449; Interrogation_Position=1695; Antisense; GATCCTGGGATTCCAGTTCTACCGT
>probe:Drosophila_2:1636623_at:561:671; Interrogation_Position=1714; Antisense; TACCGTTCCTTTTGCCTGGCAAGTG
>probe:Drosophila_2:1636623_at:31:565; Interrogation_Position=1731; Antisense; GGCAAGTGGCCAGTACAAGCCCGGT
>probe:Drosophila_2:1636623_at:679:17; Interrogation_Position=1763; Antisense; ATTTCCCACTTCACAATTGCGATTT
>probe:Drosophila_2:1636623_at:447:215; Interrogation_Position=1813; Antisense; AAGATTCGCGACATGATGCAGCTGG
>probe:Drosophila_2:1636623_at:524:53; Interrogation_Position=1828; Antisense; ATGCAGCTGGGAGCCACTCGACATT
>probe:Drosophila_2:1636623_at:438:61; Interrogation_Position=1859; Antisense; ATGTCATGGAGATAGCCACCGGTGA
>probe:Drosophila_2:1636623_at:24:411; Interrogation_Position=1898; Antisense; GACGCGGTATCCTTGAGTACTTTGC
>probe:Drosophila_2:1636623_at:26:555; Interrogation_Position=1944; Antisense; GGAGCGCAACAAGCAACTGGACATC
>probe:Drosophila_2:1636623_at:34:491; Interrogation_Position=2019; Antisense; GTACAGCACGTACTTATCTACAGGT

Paste this into a BLAST search page for me
AAGGACTATAACTGCGCTTACTGGGGGGCCTCCAGGACAAATTCGCCGGAGCCGCCATTACAACGTCTTAACAAGAAATTCCTGGCCGAGATCCTGGGATGATCCTGGGATTCCAGTTCTACCGTTACCGTTCCTTTTGCCTGGCAAGTGGGCAAGTGGCCAGTACAAGCCCGGTATTTCCCACTTCACAATTGCGATTTAAGATTCGCGACATGATGCAGCTGGATGCAGCTGGGAGCCACTCGACATTATGTCATGGAGATAGCCACCGGTGAGACGCGGTATCCTTGAGTACTTTGCGGAGCGCAACAAGCAACTGGACATCGTACAGCACGTACTTATCTACAGGT

Full Affymetrix probeset data:

Annotations for 1636623_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720