Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636625_at:

>probe:Drosophila_2:1636625_at:474:607; Interrogation_Position=1959; Antisense; TGATGGTTGCTTCTATCGCGCCCAG
>probe:Drosophila_2:1636625_at:432:455; Interrogation_Position=1983; Antisense; GATAATCGATGAATTCCCCAGTGAG
>probe:Drosophila_2:1636625_at:51:721; Interrogation_Position=1996; Antisense; TTCCCCAGTGAGTACATGATCTTCT
>probe:Drosophila_2:1636625_at:225:659; Interrogation_Position=2054; Antisense; TAAGCTGCTTGGCTCCATGTGAAAA
>probe:Drosophila_2:1636625_at:376:505; Interrogation_Position=2073; Antisense; TGAAAACGTGGACAGCTTTAAGCCC
>probe:Drosophila_2:1636625_at:195:133; Interrogation_Position=2099; Antisense; ACCGCGTCTTTAGTTTTCACATTGA
>probe:Drosophila_2:1636625_at:15:231; Interrogation_Position=2212; Antisense; AATGTACATCTGGTACAGCGCCTAC
>probe:Drosophila_2:1636625_at:665:671; Interrogation_Position=2234; Antisense; TACCGGATGGCTTCCTAATTCGCTT
>probe:Drosophila_2:1636625_at:180:279; Interrogation_Position=2248; Antisense; CTAATTCGCTTCCTGGACGATTGGA
>probe:Drosophila_2:1636625_at:372:27; Interrogation_Position=2278; Antisense; ATACCTGAACAGCTATTGCAACGCA
>probe:Drosophila_2:1636625_at:334:725; Interrogation_Position=2293; Antisense; TTGCAACGCAACTACGCTCAGGTTA
>probe:Drosophila_2:1636625_at:277:493; Interrogation_Position=2405; Antisense; GTAAGCTTTTCATTTCTGACCATGT
>probe:Drosophila_2:1636625_at:391:341; Interrogation_Position=2462; Antisense; GCTTACATTTCTTTCGAAGGACTCT
>probe:Drosophila_2:1636625_at:681:363; Interrogation_Position=2497; Antisense; GAATTATCACTACTTCGGAGCGATC

Paste this into a BLAST search page for me
TGATGGTTGCTTCTATCGCGCCCAGGATAATCGATGAATTCCCCAGTGAGTTCCCCAGTGAGTACATGATCTTCTTAAGCTGCTTGGCTCCATGTGAAAATGAAAACGTGGACAGCTTTAAGCCCACCGCGTCTTTAGTTTTCACATTGAAATGTACATCTGGTACAGCGCCTACTACCGGATGGCTTCCTAATTCGCTTCTAATTCGCTTCCTGGACGATTGGAATACCTGAACAGCTATTGCAACGCATTGCAACGCAACTACGCTCAGGTTAGTAAGCTTTTCATTTCTGACCATGTGCTTACATTTCTTTCGAAGGACTCTGAATTATCACTACTTCGGAGCGATC

Full Affymetrix probeset data:

Annotations for 1636625_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime