Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636627_at:

>probe:Drosophila_2:1636627_at:359:381; Interrogation_Position=1338; Antisense; GAACGGAGGTGCCATGGACTCTTCC
>probe:Drosophila_2:1636627_at:578:503; Interrogation_Position=1386; Antisense; GTCCATCAATGTGTACTTCCTATCG
>probe:Drosophila_2:1636627_at:479:539; Interrogation_Position=1435; Antisense; GGTTATACGCCCAGTGACACATCCA
>probe:Drosophila_2:1636627_at:503:257; Interrogation_Position=1458; Antisense; CACTGTGTCCTTGGATGTGGTGACC
>probe:Drosophila_2:1636627_at:373:169; Interrogation_Position=1523; Antisense; AAATGGCCTCACAGTCCAACATATC
>probe:Drosophila_2:1636627_at:669:271; Interrogation_Position=1542; Antisense; CATATCGCCCAAGCCGGAGATCATA
>probe:Drosophila_2:1636627_at:490:427; Interrogation_Position=1558; Antisense; GAGATCATACTCGATTCCACGCTGT
>probe:Drosophila_2:1636627_at:233:445; Interrogation_Position=1603; Antisense; GATGAGCACCGGGATGTCACGTCGC
>probe:Drosophila_2:1636627_at:517:503; Interrogation_Position=1623; Antisense; GTCGCCACTGTTCAAGCGCAAAGAT
>probe:Drosophila_2:1636627_at:252:51; Interrogation_Position=1658; Antisense; ATGCGGACGTGAGCGTTTCCGGCAA
>probe:Drosophila_2:1636627_at:210:287; Interrogation_Position=1738; Antisense; CTGGCAGGCTACGATGGCATCCAAA
>probe:Drosophila_2:1636627_at:5:213; Interrogation_Position=1771; Antisense; AAGAGACAGGCGTCCGTGGTGACCT
>probe:Drosophila_2:1636627_at:727:369; Interrogation_Position=1803; Antisense; GAATGTCATCAACTTCTCGCAGGAG
>probe:Drosophila_2:1636627_at:184:695; Interrogation_Position=1865; Antisense; TTTCCACCAGTTCCGCAAGTGAGTA

Paste this into a BLAST search page for me
GAACGGAGGTGCCATGGACTCTTCCGTCCATCAATGTGTACTTCCTATCGGGTTATACGCCCAGTGACACATCCACACTGTGTCCTTGGATGTGGTGACCAAATGGCCTCACAGTCCAACATATCCATATCGCCCAAGCCGGAGATCATAGAGATCATACTCGATTCCACGCTGTGATGAGCACCGGGATGTCACGTCGCGTCGCCACTGTTCAAGCGCAAAGATATGCGGACGTGAGCGTTTCCGGCAACTGGCAGGCTACGATGGCATCCAAAAAGAGACAGGCGTCCGTGGTGACCTGAATGTCATCAACTTCTCGCAGGAGTTTCCACCAGTTCCGCAAGTGAGTA

Full Affymetrix probeset data:

Annotations for 1636627_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime