Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636628_at:

>probe:Drosophila_2:1636628_at:492:331; Interrogation_Position=1904; Antisense; GCGGCGTGATTGTCAGTCCTGTGTC
>probe:Drosophila_2:1636628_at:305:495; Interrogation_Position=1915; Antisense; GTCAGTCCTGTGTCCCAGAATCTGG
>probe:Drosophila_2:1636628_at:476:157; Interrogation_Position=1951; Antisense; ACAACGGACAATGTGGCGCCCGGAT
>probe:Drosophila_2:1636628_at:194:153; Interrogation_Position=2033; Antisense; ACAGATATGTAAATACGCCCGGCAA
>probe:Drosophila_2:1636628_at:576:241; Interrogation_Position=2044; Antisense; AATACGCCCGGCAAACGCAGTAAAT
>probe:Drosophila_2:1636628_at:101:555; Interrogation_Position=2077; Antisense; GGACCTACGCATATACACTTTACAT
>probe:Drosophila_2:1636628_at:266:685; Interrogation_Position=2123; Antisense; TATAAAGCGTGCATGCCGTCGTTCA
>probe:Drosophila_2:1636628_at:318:711; Interrogation_Position=2144; Antisense; TTCACCTGACCCCACGGATGTGGAT
>probe:Drosophila_2:1636628_at:188:13; Interrogation_Position=2167; Antisense; ATTAGGGAACGAGGCATGCGCCGTA
>probe:Drosophila_2:1636628_at:326:71; Interrogation_Position=2178; Antisense; AGGCATGCGCCGTAGTGTTAACGGA
>probe:Drosophila_2:1636628_at:499:515; Interrogation_Position=2306; Antisense; GTGTCTGTATGTTCTTCGGTTTTAA
>probe:Drosophila_2:1636628_at:594:485; Interrogation_Position=2350; Antisense; GTAGTTAACCACGAACATCACACGA
>probe:Drosophila_2:1636628_at:602:151; Interrogation_Position=2364; Antisense; ACATCACACGAATCCGGCAGTCATT
>probe:Drosophila_2:1636628_at:514:235; Interrogation_Position=2374; Antisense; AATCCGGCAGTCATTGGCAGAGCAA

Paste this into a BLAST search page for me
GCGGCGTGATTGTCAGTCCTGTGTCGTCAGTCCTGTGTCCCAGAATCTGGACAACGGACAATGTGGCGCCCGGATACAGATATGTAAATACGCCCGGCAAAATACGCCCGGCAAACGCAGTAAATGGACCTACGCATATACACTTTACATTATAAAGCGTGCATGCCGTCGTTCATTCACCTGACCCCACGGATGTGGATATTAGGGAACGAGGCATGCGCCGTAAGGCATGCGCCGTAGTGTTAACGGAGTGTCTGTATGTTCTTCGGTTTTAAGTAGTTAACCACGAACATCACACGAACATCACACGAATCCGGCAGTCATTAATCCGGCAGTCATTGGCAGAGCAA

Full Affymetrix probeset data:

Annotations for 1636628_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime