FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636631_at:

>probe:Drosophila_2:1636631_at:137:349; Interrogation_Position=1000; Antisense; GCATGTCCATAGTGCTGGGCTTGTA
>probe:Drosophila_2:1636631_at:454:525; Interrogation_Position=1016; Antisense; GGGCTTGTATGTTCTGCTCGGATTC
>probe:Drosophila_2:1636631_at:535:335; Interrogation_Position=1031; Antisense; GCTCGGATTCTTTGGCTACTGGAAA
>probe:Drosophila_2:1636631_at:212:21; Interrogation_Position=1090; Antisense; ATATTCCGCAGTCTGAAATACCCGC
>probe:Drosophila_2:1636631_at:43:171; Interrogation_Position=1124; Antisense; AAAGGTATTCTTTGCCATCACCACT
>probe:Drosophila_2:1636631_at:475:149; Interrogation_Position=1146; Antisense; ACTTGGATCTCATATGCCTTGCAGG
>probe:Drosophila_2:1636631_at:138:617; Interrogation_Position=1165; Antisense; TGCAGGGCTATGTGACTGCCCACAT
>probe:Drosophila_2:1636631_at:543:31; Interrogation_Position=1263; Antisense; ATAATCGTGCTGCTCACTTTTGGCT
>probe:Drosophila_2:1636631_at:51:433; Interrogation_Position=1401; Antisense; GAGGGCTATGGACCATTCCGGATAA
>probe:Drosophila_2:1636631_at:159:273; Interrogation_Position=1433; Antisense; CATCAATCTGCTGCTTTTGTGCTTT
>probe:Drosophila_2:1636631_at:242:595; Interrogation_Position=1450; Antisense; TGTGCTTTGGCATCTTTGGCGGAGT
>probe:Drosophila_2:1636631_at:468:591; Interrogation_Position=1474; Antisense; TGGTGGGCACCTATGTTAGCATTTT
>probe:Drosophila_2:1636631_at:337:273; Interrogation_Position=1493; Antisense; CATTTTGGACATCATTGCGGTGTAC
>probe:Drosophila_2:1636631_at:612:577; Interrogation_Position=975; Antisense; GGCCCCTGTGGCATTTTGAATAGTG

Paste this into a BLAST search page for me
GCATGTCCATAGTGCTGGGCTTGTAGGGCTTGTATGTTCTGCTCGGATTCGCTCGGATTCTTTGGCTACTGGAAAATATTCCGCAGTCTGAAATACCCGCAAAGGTATTCTTTGCCATCACCACTACTTGGATCTCATATGCCTTGCAGGTGCAGGGCTATGTGACTGCCCACATATAATCGTGCTGCTCACTTTTGGCTGAGGGCTATGGACCATTCCGGATAACATCAATCTGCTGCTTTTGTGCTTTTGTGCTTTGGCATCTTTGGCGGAGTTGGTGGGCACCTATGTTAGCATTTTCATTTTGGACATCATTGCGGTGTACGGCCCCTGTGGCATTTTGAATAGTG

Full Affymetrix probeset data:

Annotations for 1636631_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720