FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636632_at:

>probe:Drosophila_2:1636632_at:213:465; Interrogation_Position=1389; Antisense; GATTGGCATCTTTCCGTCGGAGTAC
>probe:Drosophila_2:1636632_at:537:479; Interrogation_Position=1418; Antisense; GTTTGGCGGATTACGTAGCCTACGA
>probe:Drosophila_2:1636632_at:41:61; Interrogation_Position=1445; Antisense; ATGTCAATCAGGCTGAGTCGCCCTC
>probe:Drosophila_2:1636632_at:567:235; Interrogation_Position=1483; Antisense; AATCACCAACCGGATCCGTTTGAGA
>probe:Drosophila_2:1636632_at:101:531; Interrogation_Position=1527; Antisense; GGGTCGGCATCATCACAGGAATCGC
>probe:Drosophila_2:1636632_at:108:137; Interrogation_Position=1613; Antisense; ACGATGTGGAACTGCGTCACGGCGA
>probe:Drosophila_2:1636632_at:367:495; Interrogation_Position=1628; Antisense; GTCACGGCGAGCAATACCTGTTGAT
>probe:Drosophila_2:1636632_at:30:605; Interrogation_Position=1646; Antisense; TGTTGATATATTTCCGCAGCACCGG
>probe:Drosophila_2:1636632_at:360:487; Interrogation_Position=1752; Antisense; GTACCATGTTGACTAGCTAGCCGAG
>probe:Drosophila_2:1636632_at:196:675; Interrogation_Position=1769; Antisense; TAGCCGAGGCTCTGGATATCTTTAT
>probe:Drosophila_2:1636632_at:128:3; Interrogation_Position=1792; Antisense; ATTCTTTAGTCTCTGTTTCCATAAC
>probe:Drosophila_2:1636632_at:264:201; Interrogation_Position=1814; Antisense; AACCGCCGTGTTGATCTAATTTTAT
>probe:Drosophila_2:1636632_at:268:689; Interrogation_Position=1836; Antisense; TATTGACCTCATGTGACCGTGTTAA
>probe:Drosophila_2:1636632_at:217:481; Interrogation_Position=1861; Antisense; GTTTGCTTGTTAGCTGTTGACTCAG

Paste this into a BLAST search page for me
GATTGGCATCTTTCCGTCGGAGTACGTTTGGCGGATTACGTAGCCTACGAATGTCAATCAGGCTGAGTCGCCCTCAATCACCAACCGGATCCGTTTGAGAGGGTCGGCATCATCACAGGAATCGCACGATGTGGAACTGCGTCACGGCGAGTCACGGCGAGCAATACCTGTTGATTGTTGATATATTTCCGCAGCACCGGGTACCATGTTGACTAGCTAGCCGAGTAGCCGAGGCTCTGGATATCTTTATATTCTTTAGTCTCTGTTTCCATAACAACCGCCGTGTTGATCTAATTTTATTATTGACCTCATGTGACCGTGTTAAGTTTGCTTGTTAGCTGTTGACTCAG

Full Affymetrix probeset data:

Annotations for 1636632_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720