FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636635_at:

>probe:Drosophila_2:1636635_at:489:605; Interrogation_Position=1052; Antisense; TGAGCCATGGCCACGGATGGGACTA
>probe:Drosophila_2:1636635_at:141:129; Interrogation_Position=1105; Antisense; ACCAGCCAAGCGACAGCACTGATAT
>probe:Drosophila_2:1636635_at:439:605; Interrogation_Position=1124; Antisense; TGATATCTGATAACTGCTCCCGCTG
>probe:Drosophila_2:1636635_at:353:137; Interrogation_Position=1191; Antisense; ACGATCCCCACTCAAATTGTTACAT
>probe:Drosophila_2:1636635_at:489:215; Interrogation_Position=1222; Antisense; AATGTTGTAAGGCATCCCACTTCCT
>probe:Drosophila_2:1636635_at:474:663; Interrogation_Position=1258; Antisense; TACAAAACACCTTTCATACCTTTCG
>probe:Drosophila_2:1636635_at:686:645; Interrogation_Position=1271; Antisense; TCATACCTTTCGTTATCTGTTGGAT
>probe:Drosophila_2:1636635_at:159:683; Interrogation_Position=1284; Antisense; TATCTGTTGGATTTACCCATACCCC
>probe:Drosophila_2:1636635_at:151:319; Interrogation_Position=1321; Antisense; GCCGTCTCCCACAAGTGTACAAATT
>probe:Drosophila_2:1636635_at:52:601; Interrogation_Position=1336; Antisense; TGTACAAATTAGTCATGCGCGCGTT
>probe:Drosophila_2:1636635_at:250:51; Interrogation_Position=1350; Antisense; ATGCGCGCGTTTGTCTTTAAGTTAT
>probe:Drosophila_2:1636635_at:207:47; Interrogation_Position=817; Antisense; ATCCAGGTGTGGAAGCCCGTGAAGA
>probe:Drosophila_2:1636635_at:288:109; Interrogation_Position=884; Antisense; AGAAGGTTCAGATCTGGCGCACCGA
>probe:Drosophila_2:1636635_at:593:87; Interrogation_Position=962; Antisense; AGTCGGTCAACGTGCCCGTCTGGAA

Paste this into a BLAST search page for me
TGAGCCATGGCCACGGATGGGACTAACCAGCCAAGCGACAGCACTGATATTGATATCTGATAACTGCTCCCGCTGACGATCCCCACTCAAATTGTTACATAATGTTGTAAGGCATCCCACTTCCTTACAAAACACCTTTCATACCTTTCGTCATACCTTTCGTTATCTGTTGGATTATCTGTTGGATTTACCCATACCCCGCCGTCTCCCACAAGTGTACAAATTTGTACAAATTAGTCATGCGCGCGTTATGCGCGCGTTTGTCTTTAAGTTATATCCAGGTGTGGAAGCCCGTGAAGAAGAAGGTTCAGATCTGGCGCACCGAAGTCGGTCAACGTGCCCGTCTGGAA

Full Affymetrix probeset data:

Annotations for 1636635_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720