FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636636_at:

>probe:Drosophila_2:1636636_at:128:577; Interrogation_Position=2258; Antisense; GGCCGAGGCACTTCTAAAGTCGCTG
>probe:Drosophila_2:1636636_at:412:501; Interrogation_Position=2276; Antisense; GTCGCTGGACATATTTGAACCCTCC
>probe:Drosophila_2:1636636_at:288:95; Interrogation_Position=2309; Antisense; AGATAACAACTGAGGGTCGCCCTCT
>probe:Drosophila_2:1636636_at:176:305; Interrogation_Position=2329; Antisense; CCTCTGTTCCGCTAAAACGTTATCT
>probe:Drosophila_2:1636636_at:343:49; Interrogation_Position=2396; Antisense; AGGCCCGACGAGTGGCAACCTTATA
>probe:Drosophila_2:1636636_at:394:537; Interrogation_Position=2496; Antisense; GGTCAAGATCCCACTTGTACTTATT
>probe:Drosophila_2:1636636_at:152:675; Interrogation_Position=2533; Antisense; TAGCCGTAATTGAATGACCCCAGCC
>probe:Drosophila_2:1636636_at:648:107; Interrogation_Position=2625; Antisense; AGAATTCTATACTTTACGCCTCCAC
>probe:Drosophila_2:1636636_at:6:699; Interrogation_Position=2637; Antisense; TTTACGCCTCCACGATTTATTAGTC
>probe:Drosophila_2:1636636_at:311:11; Interrogation_Position=2666; Antisense; ATTCGATCTACACCCTAATTGGCAG
>probe:Drosophila_2:1636636_at:468:727; Interrogation_Position=2684; Antisense; TTGGCAGCCGGATGTGATAGCGATC
>probe:Drosophila_2:1636636_at:445:69; Interrogation_Position=2714; Antisense; AGTCAGGCGGGATCTTATCGCAGGT
>probe:Drosophila_2:1636636_at:537:399; Interrogation_Position=2760; Antisense; GACATCGTCAGTTACCCCAGTTGAA
>probe:Drosophila_2:1636636_at:105:667; Interrogation_Position=2791; Antisense; TACACACACACGTTGTTGCTTTATT

Paste this into a BLAST search page for me
GGCCGAGGCACTTCTAAAGTCGCTGGTCGCTGGACATATTTGAACCCTCCAGATAACAACTGAGGGTCGCCCTCTCCTCTGTTCCGCTAAAACGTTATCTAGGCCCGACGAGTGGCAACCTTATAGGTCAAGATCCCACTTGTACTTATTTAGCCGTAATTGAATGACCCCAGCCAGAATTCTATACTTTACGCCTCCACTTTACGCCTCCACGATTTATTAGTCATTCGATCTACACCCTAATTGGCAGTTGGCAGCCGGATGTGATAGCGATCAGTCAGGCGGGATCTTATCGCAGGTGACATCGTCAGTTACCCCAGTTGAATACACACACACGTTGTTGCTTTATT

Full Affymetrix probeset data:

Annotations for 1636636_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720