Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636639_at:

>probe:Drosophila_2:1636639_at:183:535; Interrogation_Position=1147; Antisense; GGTGCTCTTTGCCTATGAAGATCAT
>probe:Drosophila_2:1636639_at:560:453; Interrogation_Position=1166; Antisense; GATCATCCCGAGGAGAAGCCCGAAA
>probe:Drosophila_2:1636639_at:287:547; Interrogation_Position=1273; Antisense; GGAGGACGCAACATCCGAACAACAT
>probe:Drosophila_2:1636639_at:414:259; Interrogation_Position=1301; Antisense; CACTCGTTCCATCGTAAATGTCTTC
>probe:Drosophila_2:1636639_at:192:167; Interrogation_Position=1316; Antisense; AAATGTCTTCTGCAGCTAGCCAAGC
>probe:Drosophila_2:1636639_at:493:251; Interrogation_Position=1336; Antisense; CAAGCTCCCTTTCGTTTCGATATGG
>probe:Drosophila_2:1636639_at:154:479; Interrogation_Position=1349; Antisense; GTTTCGATATGGCTTCTCCATCTAC
>probe:Drosophila_2:1636639_at:527:37; Interrogation_Position=1368; Antisense; ATCTACCGCAGTCCATAGCTCATAT
>probe:Drosophila_2:1636639_at:274:339; Interrogation_Position=1385; Antisense; GCTCATATGGACTAACACCGCTACA
>probe:Drosophila_2:1636639_at:502:341; Interrogation_Position=1430; Antisense; GTTAGTTATGTACGTTCCTTGGCCA
>probe:Drosophila_2:1636639_at:205:581; Interrogation_Position=1449; Antisense; TGGCCAGGCACAACAATCTTATTTA
>probe:Drosophila_2:1636639_at:592:723; Interrogation_Position=1491; Antisense; TTGTAGAAAATGTTCCCTCGACTTT
>probe:Drosophila_2:1636639_at:507:711; Interrogation_Position=1543; Antisense; TTCAAATATTTCTGTGGCTCCGCAC
>probe:Drosophila_2:1636639_at:34:283; Interrogation_Position=1560; Antisense; CTCCGCACAGGAGGCTTATATGTTT

Paste this into a BLAST search page for me
GGTGCTCTTTGCCTATGAAGATCATGATCATCCCGAGGAGAAGCCCGAAAGGAGGACGCAACATCCGAACAACATCACTCGTTCCATCGTAAATGTCTTCAAATGTCTTCTGCAGCTAGCCAAGCCAAGCTCCCTTTCGTTTCGATATGGGTTTCGATATGGCTTCTCCATCTACATCTACCGCAGTCCATAGCTCATATGCTCATATGGACTAACACCGCTACAGTTAGTTATGTACGTTCCTTGGCCATGGCCAGGCACAACAATCTTATTTATTGTAGAAAATGTTCCCTCGACTTTTTCAAATATTTCTGTGGCTCCGCACCTCCGCACAGGAGGCTTATATGTTT

Full Affymetrix probeset data:

Annotations for 1636639_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime