FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636640_at:

>probe:Drosophila_2:1636640_at:263:105; Interrogation_Position=108; Antisense; AGACGGACCGACCAATGCGGTGCAA
>probe:Drosophila_2:1636640_at:253:105; Interrogation_Position=137; Antisense; AGACTGTGTTCTTTTCGCGATTCGA
>probe:Drosophila_2:1636640_at:552:375; Interrogation_Position=178; Antisense; GAAGAGGACCTAACCCGTCAATTGG
>probe:Drosophila_2:1636640_at:300:249; Interrogation_Position=196; Antisense; CAATTGGCCAGCGTGTCCTTAAAAC
>probe:Drosophila_2:1636640_at:91:585; Interrogation_Position=233; Antisense; TGGCTTCCACCTCGAATGAGCAGTT
>probe:Drosophila_2:1636640_at:30:57; Interrogation_Position=248; Antisense; ATGAGCAGTTTTTTGCCAGCAACCT
>probe:Drosophila_2:1636640_at:537:683; Interrogation_Position=325; Antisense; TATGCCGAAATCAAGAGCCTCTGGT
>probe:Drosophila_2:1636640_at:203:203; Interrogation_Position=352; Antisense; AAGGGTCATTTCTCCCAAGCTTGTA
>probe:Drosophila_2:1636640_at:100:55; Interrogation_Position=394; Antisense; ATGCAACCGCCTCGTCGTATTTCTA
>probe:Drosophila_2:1636640_at:95:483; Interrogation_Position=410; Antisense; GTATTTCTATCACCAACGAGTTCCC
>probe:Drosophila_2:1636640_at:112:247; Interrogation_Position=504; Antisense; AATTGGGTCCAATTTTGCTATGCCC
>probe:Drosophila_2:1636640_at:557:723; Interrogation_Position=518; Antisense; TTGCTATGCCCGTGCTGATGGAGGA
>probe:Drosophila_2:1636640_at:714:375; Interrogation_Position=630; Antisense; GAAGCAGCCCAAGAAGTTCGCCTTA
>probe:Drosophila_2:1636640_at:122:407; Interrogation_Position=66; Antisense; GACTGTGACCTATTCACGTTTCATC

Paste this into a BLAST search page for me
AGACGGACCGACCAATGCGGTGCAAAGACTGTGTTCTTTTCGCGATTCGAGAAGAGGACCTAACCCGTCAATTGGCAATTGGCCAGCGTGTCCTTAAAACTGGCTTCCACCTCGAATGAGCAGTTATGAGCAGTTTTTTGCCAGCAACCTTATGCCGAAATCAAGAGCCTCTGGTAAGGGTCATTTCTCCCAAGCTTGTAATGCAACCGCCTCGTCGTATTTCTAGTATTTCTATCACCAACGAGTTCCCAATTGGGTCCAATTTTGCTATGCCCTTGCTATGCCCGTGCTGATGGAGGAGAAGCAGCCCAAGAAGTTCGCCTTAGACTGTGACCTATTCACGTTTCATC

Full Affymetrix probeset data:

Annotations for 1636640_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720