FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636642_at:

>probe:Drosophila_2:1636642_at:383:593; Interrogation_Position=107; Antisense; TGGGTCGTCCCAGGCGCAAGATGAT
>probe:Drosophila_2:1636642_at:246:367; Interrogation_Position=134; Antisense; GAATCGCTAGCACCAAGTTGCAGCT
>probe:Drosophila_2:1636642_at:336:495; Interrogation_Position=15; Antisense; GTCAGACTATTCCAGCTACAGCAAC
>probe:Drosophila_2:1636642_at:157:467; Interrogation_Position=150; Antisense; GTTGCAGCTGACAAACGAGCTCATC
>probe:Drosophila_2:1636642_at:557:501; Interrogation_Position=188; Antisense; GTCGCCAATGGGAGTCGGCCTTTGA
>probe:Drosophila_2:1636642_at:575:85; Interrogation_Position=200; Antisense; AGTCGGCCTTTGAACTCGAGTTCGA
>probe:Drosophila_2:1636642_at:619:193; Interrogation_Position=212; Antisense; AACTCGAGTTCGACGCGGAGGCCAG
>probe:Drosophila_2:1636642_at:330:719; Interrogation_Position=237; Antisense; TTCCCAGCAGATGAGTGCCCTCGAT
>probe:Drosophila_2:1636642_at:455:19; Interrogation_Position=273; Antisense; ATATAGGGACAGATTGCGAACCAAT
>probe:Drosophila_2:1636642_at:633:379; Interrogation_Position=290; Antisense; GAACCAATATGCAGCGGCAACTCGA
>probe:Drosophila_2:1636642_at:295:39; Interrogation_Position=341; Antisense; ATCTCGAGGAAATCGGCAAGCTGTA
>probe:Drosophila_2:1636642_at:427:195; Interrogation_Position=37; Antisense; AACTGCAGTGGCAACTCCCAGAGGA
>probe:Drosophila_2:1636642_at:621:425; Interrogation_Position=62; Antisense; GAGAGCAATCCGTGAGCTATGCCCT
>probe:Drosophila_2:1636642_at:715:633; Interrogation_Position=86; Antisense; TCTACCTCCACCGTAGGGAGTTGGG

Paste this into a BLAST search page for me
TGGGTCGTCCCAGGCGCAAGATGATGAATCGCTAGCACCAAGTTGCAGCTGTCAGACTATTCCAGCTACAGCAACGTTGCAGCTGACAAACGAGCTCATCGTCGCCAATGGGAGTCGGCCTTTGAAGTCGGCCTTTGAACTCGAGTTCGAAACTCGAGTTCGACGCGGAGGCCAGTTCCCAGCAGATGAGTGCCCTCGATATATAGGGACAGATTGCGAACCAATGAACCAATATGCAGCGGCAACTCGAATCTCGAGGAAATCGGCAAGCTGTAAACTGCAGTGGCAACTCCCAGAGGAGAGAGCAATCCGTGAGCTATGCCCTTCTACCTCCACCGTAGGGAGTTGGG

Full Affymetrix probeset data:

Annotations for 1636642_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720