FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636643_at:

>probe:Drosophila_2:1636643_at:455:11; Interrogation_Position=1011; Antisense; ATTCAAGACCGTGTTATGTCCCAAA
>probe:Drosophila_2:1636643_at:138:503; Interrogation_Position=1028; Antisense; GTCCCAAATTCTTGATTTTGCCACT
>probe:Drosophila_2:1636643_at:75:433; Interrogation_Position=1118; Antisense; GAGGAAATTTCATGCCCTTTTAAGC
>probe:Drosophila_2:1636643_at:43:321; Interrogation_Position=1131; Antisense; GCCCTTTTAAGCAATGGACAGTTTT
>probe:Drosophila_2:1636643_at:348:585; Interrogation_Position=1145; Antisense; TGGACAGTTTTAATAGCCTATAGCT
>probe:Drosophila_2:1636643_at:673:21; Interrogation_Position=1286; Antisense; ATATATCCCTAGAACAACACAGAGA
>probe:Drosophila_2:1636643_at:575:423; Interrogation_Position=1307; Antisense; GAGACCAAACTTTGGACCTTTTGCA
>probe:Drosophila_2:1636643_at:249:395; Interrogation_Position=1342; Antisense; GAAATGTAACGCAATCCAGGCAATT
>probe:Drosophila_2:1636643_at:272:63; Interrogation_Position=1404; Antisense; ATGTGTGACCAAATCGAAGTGCTCG
>probe:Drosophila_2:1636643_at:54:245; Interrogation_Position=1472; Antisense; AATTAGCCCGAGATTTATATTTAGC
>probe:Drosophila_2:1636643_at:115:327; Interrogation_Position=1495; Antisense; GCGAGGGCGTTTTGATAATCTATTC
>probe:Drosophila_2:1636643_at:253:59; Interrogation_Position=1520; Antisense; ATGTTGATAACATTTTGCACTGTCG
>probe:Drosophila_2:1636643_at:138:707; Interrogation_Position=962; Antisense; TTACACGTGAGTGGGCGAACTGCCA
>probe:Drosophila_2:1636643_at:610:523; Interrogation_Position=974; Antisense; GGGCGAACTGCCAAATATACTTGAC

Paste this into a BLAST search page for me
ATTCAAGACCGTGTTATGTCCCAAAGTCCCAAATTCTTGATTTTGCCACTGAGGAAATTTCATGCCCTTTTAAGCGCCCTTTTAAGCAATGGACAGTTTTTGGACAGTTTTAATAGCCTATAGCTATATATCCCTAGAACAACACAGAGAGAGACCAAACTTTGGACCTTTTGCAGAAATGTAACGCAATCCAGGCAATTATGTGTGACCAAATCGAAGTGCTCGAATTAGCCCGAGATTTATATTTAGCGCGAGGGCGTTTTGATAATCTATTCATGTTGATAACATTTTGCACTGTCGTTACACGTGAGTGGGCGAACTGCCAGGGCGAACTGCCAAATATACTTGAC

Full Affymetrix probeset data:

Annotations for 1636643_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720