FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636644_at:

>probe:Drosophila_2:1636644_at:491:547; Interrogation_Position=104; Antisense; GGATGATGCGGACTACGACAACGAC
>probe:Drosophila_2:1636644_at:338:199; Interrogation_Position=123; Antisense; AACGACGACGTTGGCGGCGATGACT
>probe:Drosophila_2:1636644_at:585:547; Interrogation_Position=194; Antisense; GGAGGCGGACAACATCGAGATCATA
>probe:Drosophila_2:1636644_at:684:41; Interrogation_Position=207; Antisense; ATCGAGATCATAGCTCCCGGTGGTG
>probe:Drosophila_2:1636644_at:403:219; Interrogation_Position=252; Antisense; AAGTCCAAGCGCATTACCACAAAGT
>probe:Drosophila_2:1636644_at:181:409; Interrogation_Position=281; Antisense; GACGAAATACGAGCGCGCCAGAGTT
>probe:Drosophila_2:1636644_at:352:101; Interrogation_Position=300; Antisense; AGAGTTCTGGGCACACGAGCGCTTC
>probe:Drosophila_2:1636644_at:467:137; Interrogation_Position=314; Antisense; ACGAGCGCTTCAGATCGCCATGTGC
>probe:Drosophila_2:1636644_at:135:63; Interrogation_Position=333; Antisense; ATGTGCGCACCCATCATGGTGGAGC
>probe:Drosophila_2:1636644_at:102:627; Interrogation_Position=439; Antisense; TGCCGGATCACTCCTACGAGGACTG
>probe:Drosophila_2:1636644_at:394:553; Interrogation_Position=463; Antisense; GGAGCATCGACGAGCTCATCATGGT
>probe:Drosophila_2:1636644_at:286:647; Interrogation_Position=478; Antisense; TCATCATGGTGGACAACTAGCTAGT
>probe:Drosophila_2:1636644_at:575:187; Interrogation_Position=50; Antisense; AACACGCCGCACTTTACTATTTAAT
>probe:Drosophila_2:1636644_at:154:669; Interrogation_Position=502; Antisense; TACTCAACCCCTTTATCCATAATAA

Paste this into a BLAST search page for me
GGATGATGCGGACTACGACAACGACAACGACGACGTTGGCGGCGATGACTGGAGGCGGACAACATCGAGATCATAATCGAGATCATAGCTCCCGGTGGTGAAGTCCAAGCGCATTACCACAAAGTGACGAAATACGAGCGCGCCAGAGTTAGAGTTCTGGGCACACGAGCGCTTCACGAGCGCTTCAGATCGCCATGTGCATGTGCGCACCCATCATGGTGGAGCTGCCGGATCACTCCTACGAGGACTGGGAGCATCGACGAGCTCATCATGGTTCATCATGGTGGACAACTAGCTAGTAACACGCCGCACTTTACTATTTAATTACTCAACCCCTTTATCCATAATAA

Full Affymetrix probeset data:

Annotations for 1636644_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720