FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636645_at:

>probe:Drosophila_2:1636645_at:299:589; Interrogation_Position=1575; Antisense; TGGTTACGGCGGTAGCTGACTTTAT
>probe:Drosophila_2:1636645_at:5:709; Interrogation_Position=1609; Antisense; TTACTCGAAAACTGGCTGCATGCTT
>probe:Drosophila_2:1636645_at:408:533; Interrogation_Position=1687; Antisense; GGTGTTTCTCTCCAAGTACTTTGAG
>probe:Drosophila_2:1636645_at:354:429; Interrogation_Position=1709; Antisense; GAGTTCTATGAGTTCTACCGTACCC
>probe:Drosophila_2:1636645_at:30:1; Interrogation_Position=1724; Antisense; TACCGTACCCGTGATTTTCTTTCTG
>probe:Drosophila_2:1636645_at:107:633; Interrogation_Position=1751; Antisense; TCCGAGCTGCTGGTGAATCTTTTGG
>probe:Drosophila_2:1636645_at:49:721; Interrogation_Position=1822; Antisense; TTCCATGCCACTGCTAGAGTCCAAA
>probe:Drosophila_2:1636645_at:43:533; Interrogation_Position=1873; Antisense; GGTGGCCATTCTGCATCACATTGAA
>probe:Drosophila_2:1636645_at:660:41; Interrogation_Position=1916; Antisense; ATCGAACGCGATGTGTCCAAATATG
>probe:Drosophila_2:1636645_at:336:611; Interrogation_Position=1990; Antisense; TGACGAAATCATGAACCTCCTGCGC
>probe:Drosophila_2:1636645_at:669:243; Interrogation_Position=2030; Antisense; AATTTGGCCCGAGCATTGATCATTG
>probe:Drosophila_2:1636645_at:450:605; Interrogation_Position=2046; Antisense; TGATCATTGAGAACACTTTGCCCGT
>probe:Drosophila_2:1636645_at:19:149; Interrogation_Position=2060; Antisense; ACTTTGCCCGTGGTGTGATTTTGAA
>probe:Drosophila_2:1636645_at:412:701; Interrogation_Position=2113; Antisense; TTTTCGCTTTTCCAATACATCGTAA

Paste this into a BLAST search page for me
TGGTTACGGCGGTAGCTGACTTTATTTACTCGAAAACTGGCTGCATGCTTGGTGTTTCTCTCCAAGTACTTTGAGGAGTTCTATGAGTTCTACCGTACCCTACCGTACCCGTGATTTTCTTTCTGTCCGAGCTGCTGGTGAATCTTTTGGTTCCATGCCACTGCTAGAGTCCAAAGGTGGCCATTCTGCATCACATTGAAATCGAACGCGATGTGTCCAAATATGTGACGAAATCATGAACCTCCTGCGCAATTTGGCCCGAGCATTGATCATTGTGATCATTGAGAACACTTTGCCCGTACTTTGCCCGTGGTGTGATTTTGAATTTTCGCTTTTCCAATACATCGTAA

Full Affymetrix probeset data:

Annotations for 1636645_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720