FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636646_at:

>probe:Drosophila_2:1636646_at:49:221; Interrogation_Position=1093; Antisense; AAGTGCCCCATTTGCGGCAAGGCCT
>probe:Drosophila_2:1636646_at:65:587; Interrogation_Position=1161; Antisense; TGGAGAGAAGCCTTTCCAGTGCCCC
>probe:Drosophila_2:1636646_at:340:419; Interrogation_Position=1223; Antisense; GAGCTCATCAGCAGACCCACGTGGA
>probe:Drosophila_2:1636646_at:243:139; Interrogation_Position=1247; Antisense; ACGTCAAGAAGTACGCCTGCCAGGT
>probe:Drosophila_2:1636646_at:505:597; Interrogation_Position=1271; Antisense; TGTGCCACAAATCTTTCTCCAGGAT
>probe:Drosophila_2:1636646_at:198:77; Interrogation_Position=1291; Antisense; AGGATGTCGCTCCTGAACAAGCACT
>probe:Drosophila_2:1636646_at:679:193; Interrogation_Position=1324; Antisense; AACTGCACCATCACTATTGCGTAGG
>probe:Drosophila_2:1636646_at:698:147; Interrogation_Position=1336; Antisense; ACTATTGCGTAGGATTCTCGACATA
>probe:Drosophila_2:1636646_at:512:643; Interrogation_Position=1351; Antisense; TCTCGACATATGAATCCCTTAGCAG
>probe:Drosophila_2:1636646_at:88:113; Interrogation_Position=1390; Antisense; AGCAAACTCACATTCCGCTGGCGAA
>probe:Drosophila_2:1636646_at:615:501; Interrogation_Position=1456; Antisense; GTCGATTCGGTTTTGGTGCTACTAT
>probe:Drosophila_2:1636646_at:523:601; Interrogation_Position=1523; Antisense; TGTATATTGCCTCATTGTCACACGC
>probe:Drosophila_2:1636646_at:230:495; Interrogation_Position=1539; Antisense; GTCACACGCAGCATTTTACCAAATC
>probe:Drosophila_2:1636646_at:11:489; Interrogation_Position=1605; Antisense; GTACTGTTAAGCCAACTGTTGTTAA

Paste this into a BLAST search page for me
AAGTGCCCCATTTGCGGCAAGGCCTTGGAGAGAAGCCTTTCCAGTGCCCCGAGCTCATCAGCAGACCCACGTGGAACGTCAAGAAGTACGCCTGCCAGGTTGTGCCACAAATCTTTCTCCAGGATAGGATGTCGCTCCTGAACAAGCACTAACTGCACCATCACTATTGCGTAGGACTATTGCGTAGGATTCTCGACATATCTCGACATATGAATCCCTTAGCAGAGCAAACTCACATTCCGCTGGCGAAGTCGATTCGGTTTTGGTGCTACTATTGTATATTGCCTCATTGTCACACGCGTCACACGCAGCATTTTACCAAATCGTACTGTTAAGCCAACTGTTGTTAA

Full Affymetrix probeset data:

Annotations for 1636646_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720