Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636647_s_at:

>probe:Drosophila_2:1636647_s_at:643:97; Interrogation_Position=1030; Antisense; AGATGCTTTTGGTTCTTTGGGCAAA
>probe:Drosophila_2:1636647_s_at:183:613; Interrogation_Position=1068; Antisense; TGAAACGTGTTCCATTGCCCATTGT
>probe:Drosophila_2:1636647_s_at:7:399; Interrogation_Position=1111; Antisense; GACACGACTTAGAGGCACTCGACTT
>probe:Drosophila_2:1636647_s_at:549:537; Interrogation_Position=1158; Antisense; GGTCATTCATATGCGCGGGTGGACA
>probe:Drosophila_2:1636647_s_at:31:263; Interrogation_Position=1181; Antisense; CAGCGTGGCATTGATACCTGTCAAG
>probe:Drosophila_2:1636647_s_at:16:369; Interrogation_Position=1250; Antisense; GAATCCCGATATCAACAGACTGGTA
>probe:Drosophila_2:1636647_s_at:124:375; Interrogation_Position=1304; Antisense; GAAGTTCCAGCAGCTTATGCCAACG
>probe:Drosophila_2:1636647_s_at:607:681; Interrogation_Position=1319; Antisense; TATGCCAACGTAGCCTTGGTCAGAG
>probe:Drosophila_2:1636647_s_at:493:67; Interrogation_Position=1371; Antisense; ATGGCTTCGGAACGGCTGTGTACAC
>probe:Drosophila_2:1636647_s_at:112:601; Interrogation_Position=1389; Antisense; TGTACACCGCATGACTTGCTACTTA
>probe:Drosophila_2:1636647_s_at:87:393; Interrogation_Position=823; Antisense; GAAAGAGCGTCTACCCTATCAAGAA
>probe:Drosophila_2:1636647_s_at:681:261; Interrogation_Position=929; Antisense; CAGCCGGTTACTTTGGATGATCACA
>probe:Drosophila_2:1636647_s_at:47:187; Interrogation_Position=975; Antisense; AACAAGATGATATTCCGCAGCCCGG
>probe:Drosophila_2:1636647_s_at:627:491; Interrogation_Position=999; Antisense; GTAACACATGTTTTTCCACCGGCTG

Paste this into a BLAST search page for me
AGATGCTTTTGGTTCTTTGGGCAAATGAAACGTGTTCCATTGCCCATTGTGACACGACTTAGAGGCACTCGACTTGGTCATTCATATGCGCGGGTGGACACAGCGTGGCATTGATACCTGTCAAGGAATCCCGATATCAACAGACTGGTAGAAGTTCCAGCAGCTTATGCCAACGTATGCCAACGTAGCCTTGGTCAGAGATGGCTTCGGAACGGCTGTGTACACTGTACACCGCATGACTTGCTACTTAGAAAGAGCGTCTACCCTATCAAGAACAGCCGGTTACTTTGGATGATCACAAACAAGATGATATTCCGCAGCCCGGGTAACACATGTTTTTCCACCGGCTG

Full Affymetrix probeset data:

Annotations for 1636647_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime