FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636650_at:

>probe:Drosophila_2:1636650_at:555:455; Interrogation_Position=1131; Antisense; GATACGGATACGATAATCAGGCCAT
>probe:Drosophila_2:1636650_at:276:25; Interrogation_Position=1146; Antisense; ATCAGGCCATGGTCGTAACGCCGGT
>probe:Drosophila_2:1636650_at:558:423; Interrogation_Position=1175; Antisense; GAGAAACCCTCAGCAGCGACGATTC
>probe:Drosophila_2:1636650_at:157:409; Interrogation_Position=1192; Antisense; GACGATTCCCGTCGCTTTCTAAGGC
>probe:Drosophila_2:1636650_at:77:503; Interrogation_Position=1202; Antisense; GTCGCTTTCTAAGGCCATACAAGTA
>probe:Drosophila_2:1636650_at:226:275; Interrogation_Position=1237; Antisense; CTTACTTCTAAATCAGTCCAGCGAA
>probe:Drosophila_2:1636650_at:545:325; Interrogation_Position=1257; Antisense; GCGAAAGCAAAATGTGCACCACATT
>probe:Drosophila_2:1636650_at:714:251; Interrogation_Position=1313; Antisense; CAAGAAGTCTTCTATCAATATGGAA
>probe:Drosophila_2:1636650_at:425:699; Interrogation_Position=1400; Antisense; TTTTGATAACCCAATGTGGCCCTGA
>probe:Drosophila_2:1636650_at:103:523; Interrogation_Position=1415; Antisense; GTGGCCCTGAAAACTTATATTCGAT
>probe:Drosophila_2:1636650_at:479:175; Interrogation_Position=1638; Antisense; AAACCAATTCATTCGCAATCACCAC
>probe:Drosophila_2:1636650_at:418:9; Interrogation_Position=1648; Antisense; ATTCGCAATCACCACAAACGTTTCT
>probe:Drosophila_2:1636650_at:640:127; Interrogation_Position=1658; Antisense; ACCACAAACGTTTCTCAACACACTT
>probe:Drosophila_2:1636650_at:40:253; Interrogation_Position=1673; Antisense; CAACACACTTCCATCCGGTTAAAAT

Paste this into a BLAST search page for me
GATACGGATACGATAATCAGGCCATATCAGGCCATGGTCGTAACGCCGGTGAGAAACCCTCAGCAGCGACGATTCGACGATTCCCGTCGCTTTCTAAGGCGTCGCTTTCTAAGGCCATACAAGTACTTACTTCTAAATCAGTCCAGCGAAGCGAAAGCAAAATGTGCACCACATTCAAGAAGTCTTCTATCAATATGGAATTTTGATAACCCAATGTGGCCCTGAGTGGCCCTGAAAACTTATATTCGATAAACCAATTCATTCGCAATCACCACATTCGCAATCACCACAAACGTTTCTACCACAAACGTTTCTCAACACACTTCAACACACTTCCATCCGGTTAAAAT

Full Affymetrix probeset data:

Annotations for 1636650_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720