FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636653_at:

>probe:Drosophila_2:1636653_at:110:75; Interrogation_Position=1055; Antisense; AGGACAGCGCCACCAGCATGCTAAT
>probe:Drosophila_2:1636653_at:442:55; Interrogation_Position=1091; Antisense; ATGAGACCACCGGACTGGGCAAAAT
>probe:Drosophila_2:1636653_at:467:301; Interrogation_Position=1198; Antisense; CCCAAGTTCCAATTCGAGTTCGAGC
>probe:Drosophila_2:1636653_at:250:419; Interrogation_Position=1219; Antisense; GAGCAGGACATGACCGAGCCGCTAA
>probe:Drosophila_2:1636653_at:726:415; Interrogation_Position=1234; Antisense; GAGCCGCTAAAGAACCTGGGAGTCC
>probe:Drosophila_2:1636653_at:475:589; Interrogation_Position=1250; Antisense; TGGGAGTCCACCAGATGTTCACGCC
>probe:Drosophila_2:1636653_at:117:253; Interrogation_Position=1290; Antisense; CAAGTTGATGGATCAGCCGGTGCGC
>probe:Drosophila_2:1636653_at:279:507; Interrogation_Position=1309; Antisense; GTGCGCGTGAGCAAGATCCTGCAGA
>probe:Drosophila_2:1636653_at:45:449; Interrogation_Position=1323; Antisense; GATCCTGCAGAAGGCCTACATCAAT
>probe:Drosophila_2:1636653_at:1:351; Interrogation_Position=1375; Antisense; GCAGCTTCCTATGCCAAGTTCGTAC
>probe:Drosophila_2:1636653_at:420:133; Interrogation_Position=1467; Antisense; ACCCGCCTCAGTTCTGTTCATAGGT
>probe:Drosophila_2:1636653_at:277:713; Interrogation_Position=1483; Antisense; TTCATAGGTCACGTGGAGTATCCCA
>probe:Drosophila_2:1636653_at:721:627; Interrogation_Position=1561; Antisense; TCCATTTCTGAGTAGAGCCTTGCCC
>probe:Drosophila_2:1636653_at:619:315; Interrogation_Position=1577; Antisense; GCCTTGCCCGTTGCATTTGTGAATA

Paste this into a BLAST search page for me
AGGACAGCGCCACCAGCATGCTAATATGAGACCACCGGACTGGGCAAAATCCCAAGTTCCAATTCGAGTTCGAGCGAGCAGGACATGACCGAGCCGCTAAGAGCCGCTAAAGAACCTGGGAGTCCTGGGAGTCCACCAGATGTTCACGCCCAAGTTGATGGATCAGCCGGTGCGCGTGCGCGTGAGCAAGATCCTGCAGAGATCCTGCAGAAGGCCTACATCAATGCAGCTTCCTATGCCAAGTTCGTACACCCGCCTCAGTTCTGTTCATAGGTTTCATAGGTCACGTGGAGTATCCCATCCATTTCTGAGTAGAGCCTTGCCCGCCTTGCCCGTTGCATTTGTGAATA

Full Affymetrix probeset data:

Annotations for 1636653_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720