FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636657_at:

>probe:Drosophila_2:1636657_at:61:437; Interrogation_Position=133; Antisense; GAGGATACCTCATATCTGCGCAGTC
>probe:Drosophila_2:1636657_at:451:639; Interrogation_Position=159; Antisense; TCTGCGTATCGCTGAGTCCGAGGAA
>probe:Drosophila_2:1636657_at:351:263; Interrogation_Position=198; Antisense; CAGCGGATATCTCGATCTGAATCAA
>probe:Drosophila_2:1636657_at:681:641; Interrogation_Position=22; Antisense; TCTTTATGTCCCGTCTCTTATCTGG
>probe:Drosophila_2:1636657_at:253:341; Interrogation_Position=249; Antisense; GCTTAAGGTTTCAAGATCCCCGGAT
>probe:Drosophila_2:1636657_at:258:447; Interrogation_Position=263; Antisense; GATCCCCGGATAGCGATGGAGACTA
>probe:Drosophila_2:1636657_at:384:53; Interrogation_Position=310; Antisense; ATGCAGCTTTGCGACTTTATGAAGA
>probe:Drosophila_2:1636657_at:268:251; Interrogation_Position=366; Antisense; CAAGGAATACTCGAATGCCCCGCAT
>probe:Drosophila_2:1636657_at:388:645; Interrogation_Position=37; Antisense; TCTTATCTGGCGGTCTTGGCAATTA
>probe:Drosophila_2:1636657_at:380:641; Interrogation_Position=405; Antisense; TCTGCCCAAGGAACGCTATGTACTA
>probe:Drosophila_2:1636657_at:664:437; Interrogation_Position=430; Antisense; GAGGACTATCCCTTCAATGTCAAGT
>probe:Drosophila_2:1636657_at:719:171; Interrogation_Position=462; Antisense; AAAGCTGATGAGTCCGGGCTTCTAT
>probe:Drosophila_2:1636657_at:109:503; Interrogation_Position=473; Antisense; GTCCGGGCTTCTATCGCATAAAGTA
>probe:Drosophila_2:1636657_at:649:579; Interrogation_Position=53; Antisense; TGGCAATTATCGTCCTAACCAGTAA

Paste this into a BLAST search page for me
GAGGATACCTCATATCTGCGCAGTCTCTGCGTATCGCTGAGTCCGAGGAACAGCGGATATCTCGATCTGAATCAATCTTTATGTCCCGTCTCTTATCTGGGCTTAAGGTTTCAAGATCCCCGGATGATCCCCGGATAGCGATGGAGACTAATGCAGCTTTGCGACTTTATGAAGACAAGGAATACTCGAATGCCCCGCATTCTTATCTGGCGGTCTTGGCAATTATCTGCCCAAGGAACGCTATGTACTAGAGGACTATCCCTTCAATGTCAAGTAAAGCTGATGAGTCCGGGCTTCTATGTCCGGGCTTCTATCGCATAAAGTATGGCAATTATCGTCCTAACCAGTAA

Full Affymetrix probeset data:

Annotations for 1636657_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720