FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636658_at:

>probe:Drosophila_2:1636658_at:646:77; Interrogation_Position=148; Antisense; AGGATGCTCAGGTGCTGCGCTTCGA
>probe:Drosophila_2:1636658_at:590:617; Interrogation_Position=184; Antisense; TGCCCGAGGGCTACAAGTTTGCCGT
>probe:Drosophila_2:1636658_at:214:87; Interrogation_Position=226; Antisense; AGTCGCATCAGGAGGAAGGCCAGCT
>probe:Drosophila_2:1636658_at:381:381; Interrogation_Position=23; Antisense; GAACCCATCACTTGAGTCACCCAAT
>probe:Drosophila_2:1636658_at:550:593; Interrogation_Position=259; Antisense; TGGGCACCGATCACGAAGCAATTGT
>probe:Drosophila_2:1636658_at:667:209; Interrogation_Position=274; Antisense; AAGCAATTGTTGTCCGCGGATCCTA
>probe:Drosophila_2:1636658_at:701:447; Interrogation_Position=292; Antisense; GATCCTATGCCTATGTCGGTGACGA
>probe:Drosophila_2:1636658_at:149:441; Interrogation_Position=315; Antisense; GATGGTCAGACCTACAGCATTCAGT
>probe:Drosophila_2:1636658_at:690:155; Interrogation_Position=328; Antisense; ACAGCATTCAGTACCTGGCCGATGA
>probe:Drosophila_2:1636658_at:368:1; Interrogation_Position=387; Antisense; AGGCCCGTTCAGTGAATCCCAGGGA
>probe:Drosophila_2:1636658_at:162:89; Interrogation_Position=423; Antisense; AGTCATTCGCCAATCAAGTTCCAAT
>probe:Drosophila_2:1636658_at:445:33; Interrogation_Position=435; Antisense; ATCAAGTTCCAATTCAGCGCAAATG
>probe:Drosophila_2:1636658_at:675:147; Interrogation_Position=465; Antisense; ACTATGTCTAAGTTTCGTCTGAAGA
>probe:Drosophila_2:1636658_at:97:397; Interrogation_Position=77; Antisense; GAAATTCACTATTGCCATCGCCTTC

Paste this into a BLAST search page for me
AGGATGCTCAGGTGCTGCGCTTCGATGCCCGAGGGCTACAAGTTTGCCGTAGTCGCATCAGGAGGAAGGCCAGCTGAACCCATCACTTGAGTCACCCAATTGGGCACCGATCACGAAGCAATTGTAAGCAATTGTTGTCCGCGGATCCTAGATCCTATGCCTATGTCGGTGACGAGATGGTCAGACCTACAGCATTCAGTACAGCATTCAGTACCTGGCCGATGAAGGCCCGTTCAGTGAATCCCAGGGAAGTCATTCGCCAATCAAGTTCCAATATCAAGTTCCAATTCAGCGCAAATGACTATGTCTAAGTTTCGTCTGAAGAGAAATTCACTATTGCCATCGCCTTC

Full Affymetrix probeset data:

Annotations for 1636658_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720