FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636659_at:

>probe:Drosophila_2:1636659_at:374:573; Interrogation_Position=122; Antisense; TGGCTGTTTCCTGTGTCCAGGCCGA
>probe:Drosophila_2:1636659_at:2:303; Interrogation_Position=158; Antisense; CCCGAGCCGAGACTCGCGAGTATAA
>probe:Drosophila_2:1636659_at:566:643; Interrogation_Position=19; Antisense; TCTCGTTGCGAGTTCACAGTGACAA
>probe:Drosophila_2:1636659_at:613:567; Interrogation_Position=202; Antisense; GGCAGCTATGCCTATCAGTACCAGA
>probe:Drosophila_2:1636659_at:7:91; Interrogation_Position=218; Antisense; AGTACCAGACGTCCAATGGCATCGC
>probe:Drosophila_2:1636659_at:136:229; Interrogation_Position=232; Antisense; AATGGCATCGCTGGCCAGGAATCGG
>probe:Drosophila_2:1636659_at:81:533; Interrogation_Position=262; Antisense; GGTGGTTACTATGCCAGCGGCTCGA
>probe:Drosophila_2:1636659_at:171:571; Interrogation_Position=393; Antisense; GGCTTCCATCCTGAAGTCACTGGAG
>probe:Drosophila_2:1636659_at:586:307; Interrogation_Position=435; Antisense; CCAGCAGGAGAGTCGCCAGGGTCAA
>probe:Drosophila_2:1636659_at:56:557; Interrogation_Position=460; Antisense; GGACGATTCTAGATGGGCTTGCCAC
>probe:Drosophila_2:1636659_at:250:129; Interrogation_Position=486; Antisense; ACCACCATCACATGTTGAGCGTTAT
>probe:Drosophila_2:1636659_at:516:605; Interrogation_Position=501; Antisense; TGAGCGTTATTCGAGCTAGTTTTAA
>probe:Drosophila_2:1636659_at:253:725; Interrogation_Position=548; Antisense; TTGAGCCATCAACCATTTCCATAAA
>probe:Drosophila_2:1636659_at:499:53; Interrogation_Position=88; Antisense; ATGAACAAATTCTTCGTCCTTGCCG

Paste this into a BLAST search page for me
TGGCTGTTTCCTGTGTCCAGGCCGACCCGAGCCGAGACTCGCGAGTATAATCTCGTTGCGAGTTCACAGTGACAAGGCAGCTATGCCTATCAGTACCAGAAGTACCAGACGTCCAATGGCATCGCAATGGCATCGCTGGCCAGGAATCGGGGTGGTTACTATGCCAGCGGCTCGAGGCTTCCATCCTGAAGTCACTGGAGCCAGCAGGAGAGTCGCCAGGGTCAAGGACGATTCTAGATGGGCTTGCCACACCACCATCACATGTTGAGCGTTATTGAGCGTTATTCGAGCTAGTTTTAATTGAGCCATCAACCATTTCCATAAAATGAACAAATTCTTCGTCCTTGCCG

Full Affymetrix probeset data:

Annotations for 1636659_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720