FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636660_at:

>probe:Drosophila_2:1636660_at:175:157; Interrogation_Position=109; Antisense; ACAGCCGCCGTCATTCACTTGAATT
>probe:Drosophila_2:1636660_at:613:269; Interrogation_Position=120; Antisense; CATTCACTTGAATTCCGAGGACGCC
>probe:Drosophila_2:1636660_at:509:363; Interrogation_Position=129; Antisense; GAATTCCGAGGACGCCGACACTGTG
>probe:Drosophila_2:1636660_at:231:399; Interrogation_Position=145; Antisense; GACACTGTGGCCTACTTGAACGATC
>probe:Drosophila_2:1636660_at:254:579; Interrogation_Position=153; Antisense; GGCCTACTTGAACGATCTGGATAAT
>probe:Drosophila_2:1636660_at:336:257; Interrogation_Position=183; Antisense; CAAAGTGGTGCTGGAGGCCAAAGAT
>probe:Drosophila_2:1636660_at:160:433; Interrogation_Position=210; Antisense; GAGTGCTCTGGTCAAGCTCAGTGAA
>probe:Drosophila_2:1636660_at:403:255; Interrogation_Position=259; Antisense; CACAAGTTGTGGATCGAACAGCCCG
>probe:Drosophila_2:1636660_at:130:385; Interrogation_Position=274; Antisense; GAACAGCCCGAAAATATCCCAACCT
>probe:Drosophila_2:1636660_at:238:91; Interrogation_Position=29; Antisense; AGTATATTGTAGTTCGCAGCGACTT
>probe:Drosophila_2:1636660_at:277:283; Interrogation_Position=297; Antisense; CTGCATCGCCTTGAAACCTTATGTT
>probe:Drosophila_2:1636660_at:475:473; Interrogation_Position=331; Antisense; GTTCATAAATATGTCAAGCACCTTA
>probe:Drosophila_2:1636660_at:407:121; Interrogation_Position=46; Antisense; AGCGACTTGCGTTCCGCCCTTAGTT
>probe:Drosophila_2:1636660_at:629:513; Interrogation_Position=85; Antisense; GTGATCGCTCAGAGTTGCCATGCCA

Paste this into a BLAST search page for me
ACAGCCGCCGTCATTCACTTGAATTCATTCACTTGAATTCCGAGGACGCCGAATTCCGAGGACGCCGACACTGTGGACACTGTGGCCTACTTGAACGATCGGCCTACTTGAACGATCTGGATAATCAAAGTGGTGCTGGAGGCCAAAGATGAGTGCTCTGGTCAAGCTCAGTGAACACAAGTTGTGGATCGAACAGCCCGGAACAGCCCGAAAATATCCCAACCTAGTATATTGTAGTTCGCAGCGACTTCTGCATCGCCTTGAAACCTTATGTTGTTCATAAATATGTCAAGCACCTTAAGCGACTTGCGTTCCGCCCTTAGTTGTGATCGCTCAGAGTTGCCATGCCA

Full Affymetrix probeset data:

Annotations for 1636660_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720