Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636662_at:

>probe:Drosophila_2:1636662_at:302:641; Interrogation_Position=3745; Antisense; TCGGCGATGACATGGCTCCAGCAAA
>probe:Drosophila_2:1636662_at:389:309; Interrogation_Position=3848; Antisense; CCAAGGCACCCTGCAATGAGTTCTA
>probe:Drosophila_2:1636662_at:116:263; Interrogation_Position=3881; Antisense; CAGCGCCATTTTCTGAACCGGAAAC
>probe:Drosophila_2:1636662_at:181:569; Interrogation_Position=3909; Antisense; GGCAGTATCTGAGTTCCTTATGGAC
>probe:Drosophila_2:1636662_at:338:663; Interrogation_Position=3947; Antisense; TAAAGCTTTACATTTCCCTACAGGC
>probe:Drosophila_2:1636662_at:71:497; Interrogation_Position=3977; Antisense; GTCAGGTGATATCCTATCCGGTCAA
>probe:Drosophila_2:1636662_at:645:493; Interrogation_Position=3997; Antisense; GTCAAGGCCAATTCCACTTTCAATT
>probe:Drosophila_2:1636662_at:207:589; Interrogation_Position=4031; Antisense; TGGATGATTTTCTGGACGTGGCGAT
>probe:Drosophila_2:1636662_at:512:517; Interrogation_Position=4057; Antisense; GTGGGTACCGATGGATTGCGCAAAA
>probe:Drosophila_2:1636662_at:414:655; Interrogation_Position=4101; Antisense; TAAGGTCGACGCATCCAACGATCTA
>probe:Drosophila_2:1636662_at:316:427; Interrogation_Position=4168; Antisense; GAGATCGGAATTCCCTTCAGCTACA
>probe:Drosophila_2:1636662_at:560:549; Interrogation_Position=4213; Antisense; GGAGTGCACGGTTATCTGCTGCCCA
>probe:Drosophila_2:1636662_at:45:141; Interrogation_Position=4255; Antisense; ACGGCTCGGGATGCCTTTGAGATCA
>probe:Drosophila_2:1636662_at:341:207; Interrogation_Position=4281; Antisense; AAGCGGCATGCTGGACTACATATGA

Paste this into a BLAST search page for me
TCGGCGATGACATGGCTCCAGCAAACCAAGGCACCCTGCAATGAGTTCTACAGCGCCATTTTCTGAACCGGAAACGGCAGTATCTGAGTTCCTTATGGACTAAAGCTTTACATTTCCCTACAGGCGTCAGGTGATATCCTATCCGGTCAAGTCAAGGCCAATTCCACTTTCAATTTGGATGATTTTCTGGACGTGGCGATGTGGGTACCGATGGATTGCGCAAAATAAGGTCGACGCATCCAACGATCTAGAGATCGGAATTCCCTTCAGCTACAGGAGTGCACGGTTATCTGCTGCCCAACGGCTCGGGATGCCTTTGAGATCAAAGCGGCATGCTGGACTACATATGA

Full Affymetrix probeset data:

Annotations for 1636662_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime