FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636663_at:

>probe:Drosophila_2:1636663_at:507:539; Interrogation_Position=130; Antisense; GGTATGAGCAGTAATCCTTTCTTGT
>probe:Drosophila_2:1636663_at:89:695; Interrogation_Position=147; Antisense; TTTCTTGTTTGGGTCCACCAAGGCA
>probe:Drosophila_2:1636663_at:214:227; Interrogation_Position=166; Antisense; AAGGCACCAACAGTCCCAAATGTAG
>probe:Drosophila_2:1636663_at:527:511; Interrogation_Position=196; Antisense; GTGACCCCGAAAGTGGAGACTACAT
>probe:Drosophila_2:1636663_at:253:389; Interrogation_Position=225; Antisense; GAAACATTCATCCAGCTCAACCGAA
>probe:Drosophila_2:1636663_at:501:625; Interrogation_Position=320; Antisense; TGCCCAGCGTTCAAGGATTCTTCAA
>probe:Drosophila_2:1636663_at:404:389; Interrogation_Position=378; Antisense; GAAATCGACTCTCACTTTCGGAAAG
>probe:Drosophila_2:1636663_at:378:109; Interrogation_Position=452; Antisense; AGCAACAGTTCTCGGTTCTTTGGCA
>probe:Drosophila_2:1636663_at:357:645; Interrogation_Position=468; Antisense; TCTTTGGCAGCCACCAGAGCGAAAA
>probe:Drosophila_2:1636663_at:674:393; Interrogation_Position=526; Antisense; GAAATAGACTTTCCGCCTGAGGCGG
>probe:Drosophila_2:1636663_at:36:575; Interrogation_Position=546; Antisense; GGCGGCAATCATGAGCATCAACTTT
>probe:Drosophila_2:1636663_at:308:33; Interrogation_Position=562; Antisense; ATCAACTTTTTGACATTCGCCGTTT
>probe:Drosophila_2:1636663_at:605:303; Interrogation_Position=581; Antisense; CCGTTTTCCTCATTAAGCTCGTTAT
>probe:Drosophila_2:1636663_at:417:127; Interrogation_Position=64; Antisense; AGCCAGCAGGGCGATGACTTCAGCA

Paste this into a BLAST search page for me
GGTATGAGCAGTAATCCTTTCTTGTTTTCTTGTTTGGGTCCACCAAGGCAAAGGCACCAACAGTCCCAAATGTAGGTGACCCCGAAAGTGGAGACTACATGAAACATTCATCCAGCTCAACCGAATGCCCAGCGTTCAAGGATTCTTCAAGAAATCGACTCTCACTTTCGGAAAGAGCAACAGTTCTCGGTTCTTTGGCATCTTTGGCAGCCACCAGAGCGAAAAGAAATAGACTTTCCGCCTGAGGCGGGGCGGCAATCATGAGCATCAACTTTATCAACTTTTTGACATTCGCCGTTTCCGTTTTCCTCATTAAGCTCGTTATAGCCAGCAGGGCGATGACTTCAGCA

Full Affymetrix probeset data:

Annotations for 1636663_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720