Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636664_at:

>probe:Drosophila_2:1636664_at:524:115; Interrogation_Position=1681; Antisense; AGCATGGCATCCACGGAGCTATTAA
>probe:Drosophila_2:1636664_at:287:453; Interrogation_Position=1747; Antisense; GATCACGAAGCGATGCTCATGCTGA
>probe:Drosophila_2:1636664_at:223:381; Interrogation_Position=1837; Antisense; GAACCTTCTACTACTGAATTGCCCA
>probe:Drosophila_2:1636664_at:421:363; Interrogation_Position=1852; Antisense; GAATTGCCCACCAGTGTTGACGTTG
>probe:Drosophila_2:1636664_at:84:409; Interrogation_Position=1870; Antisense; GACGTTGCCTCTGACTCGGCGGAAA
>probe:Drosophila_2:1636664_at:267:497; Interrogation_Position=1897; Antisense; GTCAGTGAAGACTCCACGACGGATT
>probe:Drosophila_2:1636664_at:221:161; Interrogation_Position=1977; Antisense; ACAATCTTCGACCACAGAGGCCGAG
>probe:Drosophila_2:1636664_at:222:95; Interrogation_Position=2003; Antisense; AGTTGAACAGCCAAACCACCGGGAG
>probe:Drosophila_2:1636664_at:443:397; Interrogation_Position=2053; Antisense; GACAAGCTGTCTACGACCACTTTAA
>probe:Drosophila_2:1636664_at:428:443; Interrogation_Position=2095; Antisense; GATGAGTCATTTTCCGAGTCCAGTG
>probe:Drosophila_2:1636664_at:495:643; Interrogation_Position=2132; Antisense; TCTATGGGCTCGACAAGAACTCCTT
>probe:Drosophila_2:1636664_at:417:453; Interrogation_Position=2157; Antisense; GATCATGAGGTTGCTACGTGCCAGA
>probe:Drosophila_2:1636664_at:456:177; Interrogation_Position=2190; Antisense; AAACGTGCTCATCTAGTTCTAGTAA
>probe:Drosophila_2:1636664_at:67:541; Interrogation_Position=2235; Antisense; GGTTGTTGATTTCTCACGTTTCCAA

Paste this into a BLAST search page for me
AGCATGGCATCCACGGAGCTATTAAGATCACGAAGCGATGCTCATGCTGAGAACCTTCTACTACTGAATTGCCCAGAATTGCCCACCAGTGTTGACGTTGGACGTTGCCTCTGACTCGGCGGAAAGTCAGTGAAGACTCCACGACGGATTACAATCTTCGACCACAGAGGCCGAGAGTTGAACAGCCAAACCACCGGGAGGACAAGCTGTCTACGACCACTTTAAGATGAGTCATTTTCCGAGTCCAGTGTCTATGGGCTCGACAAGAACTCCTTGATCATGAGGTTGCTACGTGCCAGAAAACGTGCTCATCTAGTTCTAGTAAGGTTGTTGATTTCTCACGTTTCCAA

Full Affymetrix probeset data:

Annotations for 1636664_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime