FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636665_at:

>probe:Drosophila_2:1636665_at:399:243; Interrogation_Position=1035; Antisense; AATTTTTCTCTCAGTGTGTGGGCCA
>probe:Drosophila_2:1636665_at:127:523; Interrogation_Position=1054; Antisense; GGGCCATTTGATGACCCCAAAGCAA
>probe:Drosophila_2:1636665_at:26:263; Interrogation_Position=1084; Antisense; CAGCTCACTTTCATTACATATTCCG
>probe:Drosophila_2:1636665_at:45:93; Interrogation_Position=1159; Antisense; AGTTTTGTCAGCTCACATTACCAGA
>probe:Drosophila_2:1636665_at:181:97; Interrogation_Position=1181; Antisense; AGATAGCCCGCACACAGTCGCAGGA
>probe:Drosophila_2:1636665_at:586:267; Interrogation_Position=1230; Antisense; CAGGCACACAAATCGCACATTGGTT
>probe:Drosophila_2:1636665_at:716:259; Interrogation_Position=1290; Antisense; CACCTTGCCCCATGGTAATGATGAT
>probe:Drosophila_2:1636665_at:49:119; Interrogation_Position=1342; Antisense; AGCTGCCTTCGGTGGCTGTTACGAA
>probe:Drosophila_2:1636665_at:536:477; Interrogation_Position=790; Antisense; GTTTTTGTCGCATTTGTCAGCCACA
>probe:Drosophila_2:1636665_at:130:241; Interrogation_Position=820; Antisense; AATAATGCAGCAGCCAAGTTTCCCA
>probe:Drosophila_2:1636665_at:57:215; Interrogation_Position=835; Antisense; AAGTTTCCCACATCTCGTTTTGGCT
>probe:Drosophila_2:1636665_at:481:315; Interrogation_Position=866; Antisense; GCCTCCTGCTTTGCGAAATTATCAT
>probe:Drosophila_2:1636665_at:479:619; Interrogation_Position=900; Antisense; TGCTTTTGTGGCGTCCTTGAATGGA
>probe:Drosophila_2:1636665_at:368:689; Interrogation_Position=981; Antisense; TATTTTCCACTTGCATAACAGCGCC

Paste this into a BLAST search page for me
AATTTTTCTCTCAGTGTGTGGGCCAGGGCCATTTGATGACCCCAAAGCAACAGCTCACTTTCATTACATATTCCGAGTTTTGTCAGCTCACATTACCAGAAGATAGCCCGCACACAGTCGCAGGACAGGCACACAAATCGCACATTGGTTCACCTTGCCCCATGGTAATGATGATAGCTGCCTTCGGTGGCTGTTACGAAGTTTTTGTCGCATTTGTCAGCCACAAATAATGCAGCAGCCAAGTTTCCCAAAGTTTCCCACATCTCGTTTTGGCTGCCTCCTGCTTTGCGAAATTATCATTGCTTTTGTGGCGTCCTTGAATGGATATTTTCCACTTGCATAACAGCGCC

Full Affymetrix probeset data:

Annotations for 1636665_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720