FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636666_at:

>probe:Drosophila_2:1636666_at:47:355; Interrogation_Position=1011; Antisense; GCACCACGGCTTCGAAGAGATCTCA
>probe:Drosophila_2:1636666_at:329:451; Interrogation_Position=1029; Antisense; GATCTCAAGTCAGTCGCAAGTCGAA
>probe:Drosophila_2:1636666_at:185:657; Interrogation_Position=1056; Antisense; TAATGGAGGTAATGCCGCCACCAAC
>probe:Drosophila_2:1636666_at:236:423; Interrogation_Position=1118; Antisense; GAGAAGGCGCCAACTGCCATCGAAG
>probe:Drosophila_2:1636666_at:34:43; Interrogation_Position=1136; Antisense; ATCGAAGGCTACACACCGTTGACGC
>probe:Drosophila_2:1636666_at:465:101; Interrogation_Position=1167; Antisense; AGAGACAGGCTGCTCTCCAGGATGC
>probe:Drosophila_2:1636666_at:109:629; Interrogation_Position=1182; Antisense; TCCAGGATGCCCACGTTAAATATAG
>probe:Drosophila_2:1636666_at:95:239; Interrogation_Position=1221; Antisense; AATACAATCGTATGCCCGTTTCTGA
>probe:Drosophila_2:1636666_at:578:479; Interrogation_Position=1238; Antisense; GTTTCTGAGCCAACTTTGCGCGTGC
>probe:Drosophila_2:1636666_at:279:237; Interrogation_Position=1273; Antisense; AATCGCAATCGAACGCCAACTGGAC
>probe:Drosophila_2:1636666_at:574:347; Interrogation_Position=851; Antisense; GCACAGTCAACACAGGGCCAGGGAA
>probe:Drosophila_2:1636666_at:381:205; Interrogation_Position=938; Antisense; AAGCGATCCGTTTCCCAGGAGAGTG
>probe:Drosophila_2:1636666_at:95:427; Interrogation_Position=956; Antisense; GAGAGTGTGCGCTCGAATGCCACCA
>probe:Drosophila_2:1636666_at:382:385; Interrogation_Position=988; Antisense; GAACATTACTGTGGCCTCCAGAAGC

Paste this into a BLAST search page for me
GCACCACGGCTTCGAAGAGATCTCAGATCTCAAGTCAGTCGCAAGTCGAATAATGGAGGTAATGCCGCCACCAACGAGAAGGCGCCAACTGCCATCGAAGATCGAAGGCTACACACCGTTGACGCAGAGACAGGCTGCTCTCCAGGATGCTCCAGGATGCCCACGTTAAATATAGAATACAATCGTATGCCCGTTTCTGAGTTTCTGAGCCAACTTTGCGCGTGCAATCGCAATCGAACGCCAACTGGACGCACAGTCAACACAGGGCCAGGGAAAAGCGATCCGTTTCCCAGGAGAGTGGAGAGTGTGCGCTCGAATGCCACCAGAACATTACTGTGGCCTCCAGAAGC

Full Affymetrix probeset data:

Annotations for 1636666_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720