Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636668_at:

>probe:Drosophila_2:1636668_at:721:623; Interrogation_Position=1417; Antisense; TGCCCAACGGCTACAACTCGAGATG
>probe:Drosophila_2:1636668_at:433:175; Interrogation_Position=1461; Antisense; AAACGCTTAATTGCGCTCCAGGGCA
>probe:Drosophila_2:1636668_at:492:525; Interrogation_Position=1488; Antisense; GGGCAGAATCTGTACACGGACACGT
>probe:Drosophila_2:1636668_at:341:155; Interrogation_Position=1501; Antisense; ACACGGACACGTTCTGGTTTCCCAG
>probe:Drosophila_2:1636668_at:491:695; Interrogation_Position=1518; Antisense; TTTCCCAGTTGCTGTGTCTGCACGA
>probe:Drosophila_2:1636668_at:143:499; Interrogation_Position=1533; Antisense; GTCTGCACGATAGCCGCCAATTAAA
>probe:Drosophila_2:1636668_at:690:309; Interrogation_Position=1548; Antisense; GCCAATTAAATGTGTCCAGCGGACG
>probe:Drosophila_2:1636668_at:404:225; Interrogation_Position=1580; Antisense; AAGGACGAGACCATACTCTCAGCGG
>probe:Drosophila_2:1636668_at:536:281; Interrogation_Position=1595; Antisense; CTCTCAGCGGCGATTTTGGCAAATT
>probe:Drosophila_2:1636668_at:123:389; Interrogation_Position=1670; Antisense; GAAACACTCAATATCTCTCATGTTG
>probe:Drosophila_2:1636668_at:194:359; Interrogation_Position=1760; Antisense; GCAAAATTGGATTTATGCCCACACA
>probe:Drosophila_2:1636668_at:234:311; Interrogation_Position=1778; Antisense; CCACACAATCCCTTTGAGTTTGCAT
>probe:Drosophila_2:1636668_at:162:677; Interrogation_Position=1811; Antisense; TAGTCTTACCCTGTGAGCGATCTAA
>probe:Drosophila_2:1636668_at:488:19; Interrogation_Position=1854; Antisense; ATATTCCACGCGATGCTTTTTCAAG

Paste this into a BLAST search page for me
TGCCCAACGGCTACAACTCGAGATGAAACGCTTAATTGCGCTCCAGGGCAGGGCAGAATCTGTACACGGACACGTACACGGACACGTTCTGGTTTCCCAGTTTCCCAGTTGCTGTGTCTGCACGAGTCTGCACGATAGCCGCCAATTAAAGCCAATTAAATGTGTCCAGCGGACGAAGGACGAGACCATACTCTCAGCGGCTCTCAGCGGCGATTTTGGCAAATTGAAACACTCAATATCTCTCATGTTGGCAAAATTGGATTTATGCCCACACACCACACAATCCCTTTGAGTTTGCATTAGTCTTACCCTGTGAGCGATCTAAATATTCCACGCGATGCTTTTTCAAG

Full Affymetrix probeset data:

Annotations for 1636668_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime