Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636672_at:

>probe:Drosophila_2:1636672_at:705:127; Interrogation_Position=122; Antisense; ACCACTCCTGTCTGCCAGAAGAAGA
>probe:Drosophila_2:1636672_at:328:653; Interrogation_Position=180; Antisense; TCAAGGTGGCCTGCAAAATCTTCAA
>probe:Drosophila_2:1636672_at:385:165; Interrogation_Position=195; Antisense; AAATCTTCAAGGCATCGGGCCACCA
>probe:Drosophila_2:1636672_at:527:41; Interrogation_Position=208; Antisense; ATCGGGCCACCAGCAACTGAAGAAC
>probe:Drosophila_2:1636672_at:283:613; Interrogation_Position=225; Antisense; TGAAGAACCACTCCATGCCGAAGGA
>probe:Drosophila_2:1636672_at:445:119; Interrogation_Position=276; Antisense; AGCTGCAGAACTCCCAGAACGAGCA
>probe:Drosophila_2:1636672_at:673:377; Interrogation_Position=305; Antisense; GAAGCCGAGCTCGTCCAACTGTAAT
>probe:Drosophila_2:1636672_at:704:383; Interrogation_Position=34; Antisense; GAACAGCCAAGATCAGTCGACCAAG
>probe:Drosophila_2:1636672_at:684:163; Interrogation_Position=355; Antisense; AAATACCACTTTCCAATCAGCTTTA
>probe:Drosophila_2:1636672_at:602:405; Interrogation_Position=382; Antisense; GACTCCAACGGATTCGGTCTCTAAA
>probe:Drosophila_2:1636672_at:472:537; Interrogation_Position=397; Antisense; GGTCTCTAAACATCATCCGCAACAG
>probe:Drosophila_2:1636672_at:418:117; Interrogation_Position=420; Antisense; AGCTTTAACTCTCCACACTGTGCAA
>probe:Drosophila_2:1636672_at:389:47; Interrogation_Position=474; Antisense; ATCCAGCTTTAATCATTGTCTTCCA
>probe:Drosophila_2:1636672_at:589:227; Interrogation_Position=82; Antisense; AATGGCCTACGAAACTCTGATGAAC

Paste this into a BLAST search page for me
ACCACTCCTGTCTGCCAGAAGAAGATCAAGGTGGCCTGCAAAATCTTCAAAAATCTTCAAGGCATCGGGCCACCAATCGGGCCACCAGCAACTGAAGAACTGAAGAACCACTCCATGCCGAAGGAAGCTGCAGAACTCCCAGAACGAGCAGAAGCCGAGCTCGTCCAACTGTAATGAACAGCCAAGATCAGTCGACCAAGAAATACCACTTTCCAATCAGCTTTAGACTCCAACGGATTCGGTCTCTAAAGGTCTCTAAACATCATCCGCAACAGAGCTTTAACTCTCCACACTGTGCAAATCCAGCTTTAATCATTGTCTTCCAAATGGCCTACGAAACTCTGATGAAC

Full Affymetrix probeset data:

Annotations for 1636672_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime