FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636675_at:

>probe:Drosophila_2:1636675_at:337:695; Interrogation_Position=1001; Antisense; TTAGCGGATGCTTCAATGGTCATAC
>probe:Drosophila_2:1636675_at:160:625; Interrogation_Position=467; Antisense; TGCCCAACTCCAAGAGCTTCGATGA
>probe:Drosophila_2:1636675_at:159:343; Interrogation_Position=482; Antisense; GCTTCGATGATTACGCTCTGGGCAT
>probe:Drosophila_2:1636675_at:341:555; Interrogation_Position=561; Antisense; GGACCATAACGTGCTGGGCTCAAGT
>probe:Drosophila_2:1636675_at:420:681; Interrogation_Position=589; Antisense; TATGCACCGGCTTCTACAAGGGCAA
>probe:Drosophila_2:1636675_at:192:539; Interrogation_Position=621; Antisense; GGTAATTCCCAGGACATCGCACAAT
>probe:Drosophila_2:1636675_at:21:251; Interrogation_Position=642; Antisense; CAATGGCTGCCATCAGAGTGCATTT
>probe:Drosophila_2:1636675_at:395:363; Interrogation_Position=667; Antisense; GAATTGGCAATGAGCCGGACTCCAT
>probe:Drosophila_2:1636675_at:367:347; Interrogation_Position=786; Antisense; GCAGGACACTTCTGTTGACTTTGGT
>probe:Drosophila_2:1636675_at:452:395; Interrogation_Position=840; Antisense; GAAATCGCTGCCATTGAATCACCTG
>probe:Drosophila_2:1636675_at:173:223; Interrogation_Position=875; Antisense; AAGGATTTTCCCGAGACGACCAGTG
>probe:Drosophila_2:1636675_at:121:691; Interrogation_Position=903; Antisense; TTTGGACTTTCAGACGGAGCAGCGC
>probe:Drosophila_2:1636675_at:477:415; Interrogation_Position=939; Antisense; GAGCCAAAGCTTTTCTATTTTCCAT
>probe:Drosophila_2:1636675_at:328:133; Interrogation_Position=979; Antisense; ACCCGCCGCAATTTGCTGAAGTTTA

Paste this into a BLAST search page for me
TTAGCGGATGCTTCAATGGTCATACTGCCCAACTCCAAGAGCTTCGATGAGCTTCGATGATTACGCTCTGGGCATGGACCATAACGTGCTGGGCTCAAGTTATGCACCGGCTTCTACAAGGGCAAGGTAATTCCCAGGACATCGCACAATCAATGGCTGCCATCAGAGTGCATTTGAATTGGCAATGAGCCGGACTCCATGCAGGACACTTCTGTTGACTTTGGTGAAATCGCTGCCATTGAATCACCTGAAGGATTTTCCCGAGACGACCAGTGTTTGGACTTTCAGACGGAGCAGCGCGAGCCAAAGCTTTTCTATTTTCCATACCCGCCGCAATTTGCTGAAGTTTA

Full Affymetrix probeset data:

Annotations for 1636675_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720