FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636676_at:

>probe:Drosophila_2:1636676_at:275:659; Interrogation_Position=1072; Antisense; TAACGCATTACTAGCTCGTAAGTGT
>probe:Drosophila_2:1636676_at:392:287; Interrogation_Position=626; Antisense; CGGATCGTATGGAGCCCCTTCAAGG
>probe:Drosophila_2:1636676_at:137:681; Interrogation_Position=663; Antisense; TATGGAGCGCCCTTCTAGATCTTCG
>probe:Drosophila_2:1636676_at:41:679; Interrogation_Position=678; Antisense; TAGATCTTCGCACAGGTCTCACATC
>probe:Drosophila_2:1636676_at:255:393; Interrogation_Position=704; Antisense; GAAAGACACACCTCTGCCAAAAATG
>probe:Drosophila_2:1636676_at:619:611; Interrogation_Position=727; Antisense; TGAATACCGACGGACACGAAACCGA
>probe:Drosophila_2:1636676_at:451:409; Interrogation_Position=756; Antisense; GACGACACCAACACTATACAAATTT
>probe:Drosophila_2:1636676_at:519:161; Interrogation_Position=775; Antisense; AAATTTGGGCAACCTGGATCTAATA
>probe:Drosophila_2:1636676_at:228:241; Interrogation_Position=796; Antisense; AATAATGGAACTACCGATCACCGAT
>probe:Drosophila_2:1636676_at:171:47; Interrogation_Position=819; Antisense; ATCCGCTCTGATCCCGAGAGAACTG
>probe:Drosophila_2:1636676_at:503:425; Interrogation_Position=834; Antisense; GAGAGAACTGGAGATCGCTTCCCCT
>probe:Drosophila_2:1636676_at:614:141; Interrogation_Position=886; Antisense; ACTGTACCCCAACACTCTGAAACGT
>probe:Drosophila_2:1636676_at:638:249; Interrogation_Position=928; Antisense; CAAACAATTCGGGACTTCGTCTCGG
>probe:Drosophila_2:1636676_at:290:479; Interrogation_Position=977; Antisense; GTTTCTCACACTACACGAATACAAG

Paste this into a BLAST search page for me
TAACGCATTACTAGCTCGTAAGTGTCGGATCGTATGGAGCCCCTTCAAGGTATGGAGCGCCCTTCTAGATCTTCGTAGATCTTCGCACAGGTCTCACATCGAAAGACACACCTCTGCCAAAAATGTGAATACCGACGGACACGAAACCGAGACGACACCAACACTATACAAATTTAAATTTGGGCAACCTGGATCTAATAAATAATGGAACTACCGATCACCGATATCCGCTCTGATCCCGAGAGAACTGGAGAGAACTGGAGATCGCTTCCCCTACTGTACCCCAACACTCTGAAACGTCAAACAATTCGGGACTTCGTCTCGGGTTTCTCACACTACACGAATACAAG

Full Affymetrix probeset data:

Annotations for 1636676_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720